Rhiza Labs FluTracker Forum

The place to discuss the flu
It is currently Sat May 25, 2013 8:34 am

All times are UTC - 5 hours [ DST ]




Post new topic Reply to topic  [ 91 posts ]  Go to page Previous  1, 2, 3, 4, 5, 6 ... 10  Next
Author Message
PostPosted: Fri Jan 07, 2011 12:41 am 
Online

Joined: Wed Aug 19, 2009 10:42 am
Posts: 27558
Location: Pittsburgh, PA USA
cpg wrote:
niman wrote:
S188T is a receptor binding domain change that was in 22 of the 41 sequences from the UK. However, a second receptor binding domain change S186P was present in 14 more of the sequences. Thus, as was seen in seasonal H1N1, changes flanking position 190 are driving the newly emerging sequences.

S186P pedigree
EPI295396 A/SAGA/90/2010 (A/H1N1 swl) segment 4 (HA) 27.0 5.73352
EPI295385 A/SAGA/85/2010 (A/H1N1 swl) segment 4 (HA) 27.0 5.73352
EPI295384 A/CHIBA/23/2010 (A/H1N1 swl) segment 4 (HA) 27.0 5.73352
EPI294682 A/England/118/2010 (A/H1N1 swl) segment 4 (HA) 27.0 5.73352
EPI294040 A/NAGANO/2181/2010 (A/H1N1 swl) segment 4 (HA) 27.0 5.73352
EPI294029 A/YOKOHAMA/84/2010 (A/H1N1 swl) segment 4 (HA) 27.0 5.73352
EPI288179 A/Belgorod/RII4/2009 (A/H1N1) segment 4 (HA) 27.0 5.73352
EPI286652 A/Stockholm/5/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI284314 A/Myanmar/M536/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI280326 A/Wisconsin/08/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI280286 A/Florida/13/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI279208 A/CANBERRA/8/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI279016 A/GOROKA/16/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI278875 A/India/007/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI278516 A/Ukraine/122/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI278514 A/Ukraine/123/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI277042 A/Singapore/478/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI273897 A/India/3725/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI272842 A/Qingdao/492/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI272392 A/CHIBA-C/22/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI272008 A/WELLINGTON/1/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI269839 A/turkey/Ontario/FAV114-17/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI269838 A/turkey/Ontario/FAV117-1C/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI259196 A/swine/NC/19646/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI257748 A/Jiangxi-Donghu/SWL1172/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI256035 A/Thessaloniki/791/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI252354 A/Ontario/25913/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI246200 A/swine/IL/5265-2/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI246197 A/swine/IL/5265-1/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI244053 A/swine/Illinois/02957/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI244041 A/KYOTO/2/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI238359 A/Chernihiv/857/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI237302 A/California/VRDL7/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI230786 A/Ankara/17/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI230497 A/swine/4/Mexico/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI217181 A/Tennessee/17/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI215819 A/DARWIN/2126/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI210034 A/FUKUOKA-C/2/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI252306 A/Ontario/10016/2009 (A/H1N1 swl) segment 4 (HA) 51.0 0.00000
EPI226552 A/YOKOHAMA/1311/2009 (A/H1N1 swl) segment 4 (HA) 51.0 0.00000
EPI244054 A/swine/Illinois/02960/2010 (A/H1N1 swl) segment 4 (HA) 49.1 0.00000




And some of us know what this means if you go by historical data.

Yes pandemic H1N1 is following the footsteps of seasonal H1N1

http://precedings.nature.com/documents/2832/version/1

_________________
www.twitter.com/hniman


Top
 Profile  
 
PostPosted: Fri Jan 07, 2011 12:49 am 
Offline

Joined: Fri Sep 11, 2009 8:30 am
Posts: 687
niman wrote:
cpg wrote:
niman wrote:
S188T is a receptor binding domain change that was in 22 of the 41 sequences from the UK. However, a second receptor binding domain change S186P was present in 14 more of the sequences. Thus, as was seen in seasonal H1N1, changes flanking position 190 are driving the newly emerging sequences.

S186P pedigree
EPI295396 A/SAGA/90/2010 (A/H1N1 swl) segment 4 (HA) 27.0 5.73352
EPI295385 A/SAGA/85/2010 (A/H1N1 swl) segment 4 (HA) 27.0 5.73352
EPI295384 A/CHIBA/23/2010 (A/H1N1 swl) segment 4 (HA) 27.0 5.73352
EPI294682 A/England/118/2010 (A/H1N1 swl) segment 4 (HA) 27.0 5.73352
EPI294040 A/NAGANO/2181/2010 (A/H1N1 swl) segment 4 (HA) 27.0 5.73352
EPI294029 A/YOKOHAMA/84/2010 (A/H1N1 swl) segment 4 (HA) 27.0 5.73352
EPI288179 A/Belgorod/RII4/2009 (A/H1N1) segment 4 (HA) 27.0 5.73352
EPI286652 A/Stockholm/5/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI284314 A/Myanmar/M536/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI280326 A/Wisconsin/08/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI280286 A/Florida/13/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI279208 A/CANBERRA/8/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI279016 A/GOROKA/16/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI278875 A/India/007/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI278516 A/Ukraine/122/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI278514 A/Ukraine/123/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI277042 A/Singapore/478/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI273897 A/India/3725/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI272842 A/Qingdao/492/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI272392 A/CHIBA-C/22/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI272008 A/WELLINGTON/1/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI269839 A/turkey/Ontario/FAV114-17/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI269838 A/turkey/Ontario/FAV117-1C/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI259196 A/swine/NC/19646/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI257748 A/Jiangxi-Donghu/SWL1172/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI256035 A/Thessaloniki/791/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI252354 A/Ontario/25913/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI246200 A/swine/IL/5265-2/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI246197 A/swine/IL/5265-1/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI244053 A/swine/Illinois/02957/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI244041 A/KYOTO/2/2010 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI238359 A/Chernihiv/857/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI237302 A/California/VRDL7/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI230786 A/Ankara/17/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI230497 A/swine/4/Mexico/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI217181 A/Tennessee/17/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI215819 A/DARWIN/2126/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI210034 A/FUKUOKA-C/2/2009 (A/H1N1 swl) segment 4 (HA) 52.8 0.00000
EPI252306 A/Ontario/10016/2009 (A/H1N1 swl) segment 4 (HA) 51.0 0.00000
EPI226552 A/YOKOHAMA/1311/2009 (A/H1N1 swl) segment 4 (HA) 51.0 0.00000
EPI244054 A/swine/Illinois/02960/2010 (A/H1N1 swl) segment 4 (HA) 49.1 0.00000




And some of us know what this means if you go by historical data.

Yes pandemic H1N1 is following the footsteps of seasonal H1N1

http://precedings.nature.com/documents/2832/version/1



For Dingo so he can follow it.

So if it follows this path. Tamiflu will become 99.9% USELESS due to the H274Y mutation becoming fixed in P/H1N1 which is now called our seasonal flu.

So that leaves one approved anti-viral left to combat H1N1. We will wait and see if Relenza becomes resistant down the track. We do know 100% that relenza still works effectively on the H274Y H1N1 strain. As seen in the recent study published yesterday.


Top
 Profile  
 
PostPosted: Fri Jan 07, 2011 1:05 am 
Online

Joined: Wed Aug 19, 2009 10:42 am
Posts: 27558
Location: Pittsburgh, PA USA
Clarifucation. Drivers, like S166P and S188T can drive any hitchhiking polymorphism, including D225G.

http://www.youtube.com/watch?v=mvsmRuRp4cM

_________________
www.twitter.com/hniman


Last edited by niman on Fri Jan 07, 2011 1:12 am, edited 1 time in total.

Top
 Profile  
 
PostPosted: Fri Jan 07, 2011 1:12 am 
Offline

Joined: Sat Jan 30, 2010 2:44 am
Posts: 887
cpg wrote:
For Dingo so he can follow it.

So if it follows this path. Tamiflu will become 99.9% USELESS due to the H274Y mutation becoming fixed in P/H1N1 which is now called our seasonal flu.

So that leaves one approved anti-viral left to combat H1N1. We will wait and see if Relenza becomes resistant down the track. We do know 100% that relenza still works effectively on the H274Y H1N1 strain. As seen in the recent study published yesterday.


From NS1's first post:

NS1 wrote:
Clinically verified TamiFlu ineffectiveness is occurring more frequently than genetically verified H275Y resistance. Resolving for "late start" and other confounders, failure to clear virus upon treatment is more widespread than may be explained strictly by the manifested genetic record on the single Neuraminidase polymorphisms. Perhaps the sample preparation, timing or even the pyrosequencing is somehow failing to elucidate or manifest the NA polymorphism? For the moment, the slate is open to inspection due to the lack of sufficient explanation for the excess clinical resistance.



And eventually as swine flu becomes the new seasonal flu it will become both milder and resistant to Tamiflu.

Seasonal flu Tamiflu resistance didn't result in massive Relenza sales, did it?

You are now spuiking Relenza in virtually every post. In most forums I've been involved with over the years, you'd be banned for spamming.


Top
 Profile  
 
PostPosted: Fri Jan 07, 2011 1:14 am 
Offline

Joined: Fri Sep 11, 2009 8:30 am
Posts: 687
As hitchhiking polymorphisms go H274Y seems to be very efficent along with D225 judging by the evidence from these latest sequences.


Last edited by cpg on Fri Jan 07, 2011 1:26 am, edited 1 time in total.

Top
 Profile  
 
PostPosted: Fri Jan 07, 2011 1:18 am 
Offline

Joined: Fri Sep 11, 2009 8:30 am
Posts: 687
Dingo wrote:
cpg wrote:
For Dingo so he can follow it.

So if it follows this path. Tamiflu will become 99.9% USELESS due to the H274Y mutation becoming fixed in P/H1N1 which is now called our seasonal flu.

So that leaves one approved anti-viral left to combat H1N1. We will wait and see if Relenza becomes resistant down the track. We do know 100% that relenza still works effectively on the H274Y H1N1 strain. As seen in the recent study published yesterday.


From NS1's first post:

NS1 wrote:
Clinically verified TamiFlu ineffectiveness is occurring more frequently than genetically verified H275Y resistance. Resolving for "late start" and other confounders, failure to clear virus upon treatment is more widespread than may be explained strictly by the manifested genetic record on the single Neuraminidase polymorphisms. Perhaps the sample preparation, timing or even the pyrosequencing is somehow failing to elucidate or manifest the NA polymorphism? For the moment, the slate is open to inspection due to the lack of sufficient explanation for the excess clinical resistance.



And eventually as swine flu becomes the new seasonal flu it will become both milder and resistant to Tamiflu.

Seasonal flu Tamiflu resistance didn't result in massive Relenza sales, did it?

You are now spuiking Relenza in virtually every post. In most forums I've been involved with over the years, you'd be banned for spamming.


Seasonal H1N1 H274Y fixing co-incided with Novel Swine flu H1N1 so old seasonal H1N1 was swamped and dominated and didnt exist much anymore. Read up some more.

You have lost the plot now. What forums you talking about !!!


Last edited by cpg on Fri Jan 07, 2011 4:22 am, edited 1 time in total.

Top
 Profile  
 
PostPosted: Fri Jan 07, 2011 1:52 am 
Online

Joined: Wed Aug 19, 2009 10:42 am
Posts: 27558
Location: Pittsburgh, PA USA
Commentary at

http://www.recombinomics.com/News/01071 ... Clade.html

_________________
www.twitter.com/hniman


Top
 Profile  
 
PostPosted: Fri Jan 07, 2011 2:21 am 
Offline

Joined: Wed Oct 07, 2009 5:01 am
Posts: 15
Location: USA
niman wrote:
NS1 wrote:
All four of the earlier released sequences that had no clinical outcomes at initial release are noted as fatal on this chart if we are reading correctly.

The four cases are each genetically divergent.

Three share the common 377K. No individual change appears on all four fatal sequences. In fact, no two of the four share any other polymorphism than the three sharing 377K.

3 out of 4 were fatal. They were early and representative. Now S188T is dominant.


All four are on the Ellis Figure3 [1] chart marked as fatality and all four were updated yesterday on GISAID as "Deceased". Two were recent and all four are divergent.

GISAID 2010-12-20 deposited sequences are notated with green boxes on the Ellis Figure3 [1] chart.

UK_2010_Phylo_ELLIS_Fig3new_4_GISAID_Notated.jpg

Fatal Sequences from Ellis Figure 3 In GISAID 2010-12-20 Deposit

  • UKWhiteChapel4880374_2M_2010_11_28_f
  • UKCambridge118_4F_2010_11_19_f
  • UKWhiteChapel4780352_5M_2010_10_26_f
  • UKBirmingham3220137_44F_2010_08_07_f

GeneWurx_UK_December_Emerging_Genetics_v3.xls

Hyper-Zoonotic Polymorphism Details

Please excuse the intermediate markings on these sequences. The following are rough lab notes, but divergence may be ascertained easily.

The common ground among these sequences and those in the database on either side of them temporally, especially Iran, is the high quantity of polymorphisms that are novel or rare to pH1N1 and that also appear in zoonotic reservoirs, particularly H3N8, H5N1 and H7N7.

Even small genetic adjustments from animal vectors into human infections, especially H3N8, may create variant behaviour. This potential era of zoonotic sub-segment spillover merits as much investigation for severity (in combination) as does the recognised 225G.

. . . . UKWhiteChapel4880374_2M_2010_11_28_f (
. . . . . . . . 0A (gCC) [1918 (GCT), S7 (GCT), S5 (GCA)]
. . . . . . . . syn55L [S9, H5N1],
. . . . . . . . . . . . . . [Darwin47_2010_08_09 with syn529L,
. . . . . . . . . . . . . . Iran16273_2009_11_22 with 226R
. . . . . . . . . . . . . . NZ_Waikato2_2010_01_04 with 233H,
. . . . . . . . . . . . . . tkOntarioFAV117_1C_2009_12_07 mult domain matches, et al],
. . . . . . . . 188T [H6N1, H7N7],
. . . . . . . . syn338G [H3N8, H4, H5, H6, sw],
. . . . . . . . . . . . . . . [OzBrisbane209_51F_2010_08_09
. . . . . . . . . . . . . . . . . . . . with 156E & 225G,
. . . . . . . . . . . . . . . Arizona05_2010_05_11 with 0A,
. . . . . . . . . . . . . . . Swine Asia 2005 with 0A, et al]
. . . . . . . . 377K,
. . . . . . . . 454N [H7N3, H7N7, H9N2]
. . . . . . . . . . [Florida14_24M_2010_08_05
. . . . . . . . . . . . . . . . . . with 188T, 454N,
. . . . . . . . . . FL_Pen210_2009_11_10
. . . . . . . . . . . . . . . . . . with 225E,
. . . . . . . . . . SouthCarolina18_2009_09_16_VxX
. . . . . . . . . . . . . . . . . . with 159D, 224K, et al],
. . . . . . . . syn529L (CTt) [Unique to PF11]
. . . . . . . . . . . . . . . . . . . . [S7 (CTt), tn with syn338G (GGg)]
. . . . . . . . . . . . . . . . . . . . [PF11 32 Worldwide (CTa),
. . . . . . . . . . . . . . . . . . . . PF11 5 North America (tTG)],
. . . . . . . . . . . . . . . . . . . . [swThailandCU_CHK4_2009_01 (tTG)
. . . . . . . . . . . . . . . . . . . . . . . . . . with 0A, syn338G, 189T, 377G, syn451K, syn456L])

. . . . UKCambridge118_4F_2010_11_19_f (
. . . . . . . . syn118E tcatttgaaaggtttgaA,
. . . . . . . . 137T [MoldovaG170_2009,
. . . . . . . . . . . . . 41 sequences at GISAID],
. . . . . . . . syn163K,
. . . . . . . . 186P,
. . . . . . . . syn251L gaagcaactggaaatctG,
. . . . . . . . syn293L gctataaacaccagcctT,
. . . . . . . . syn363G [21 sequences at GISAID],
. . . . . . . . syn455Q caAttaaaaaacaatgcc ,
. . . . . . . . syn474C [H3N8],
. . . . . . . . 504G ttaaacagagaagaaatagGt,
. . . . . . . . 513V [1918, S5, tn] Gtttaccagattttggcgatc)

. . . . UKWhiteChapel4780352_5M_2010_10_26_f (
. . . . . . . . syn58C,
. . . . . . . . 100N,
. . . . . . . . 128D,
. . . . . . . . syn131S tcaaacaaaggtgtaacggca,
. . . . . . . . syn210S,
. . . . . . . . 377K)

. . . . UKBirmingham3220137_44F_2010_08_07_f (
. . . . . . . . #8A gcagttctgctatatacattt,
. . . . . . . . 175K aaagtcctcgtgctatgg,
. . . . . . . . 311E Gaaagcacaaaattgaga,
. . . . . . . . 377K,
. . . . . . . . syn385V gtCattgaaaagatgaat,
. . . . . . . . syn451K aagaacttatatgaaaaA,
. . . . . . . . syn454S agTcagttaaaaaacaatgcc,
. . . . . . . . syn494E,
. . . . . . . . 537G [S5] tccctgggggcaatcGgt)

1. Ellis J, Galiano M, Pebody R, Lackenby A, Thompson C, Bermingham A, McLean E, Zhao H, Bolotin S, Dar O, Watson JM, Zambon M. Virological analysis of fatal influenza cases in the United Kingdom during the early wave of influenza in winter 2010/11. Euro Surveill. 2011;16(1):pii=19760. Available online: http://www.eurosurveillance.org/ViewArt ... leId=19760

_________________
http://genewurx.com/
Independent Primary Research on Viral Genetics and the
Host-Pathogen Immune Dynamics of Zoonotic Influenza Reservoirs


Last edited by NS1 on Fri Jan 07, 2011 5:34 am, edited 4 times in total.

Top
 Profile  
 
PostPosted: Fri Jan 07, 2011 3:36 am 
Offline

Joined: Sat Jan 30, 2010 2:44 am
Posts: 887
Dingo wrote:
cpg wrote:

And eventually as swine flu becomes the new seasonal flu it will become both milder and resistant to Tamiflu.

Seasonal flu Tamiflu resistance didn't result in massive Relenza sales, did it?

You are now spuiking Relenza in virtually every post. In most forums I've been involved with over the years, you'd be banned for spamming.


Seasonal H1N1 H274Y fixing co-incided with Novel Swine flu H1N1 so old seasonal H1N1 didnt exist anymore. Read up some more.

You have lost the plot now. What forums you talking about !!!


Who is talking about old seasonal flu? Looks like you have trouble with tenses and comprehension generally. In each pandemic, the new flu becomes "the seasonal flu" as I posted above.

Re forums, I've been on all sorts for nearly decade, including at the Moderator and Administrator level which included banning spammers like you.


Top
 Profile  
 
PostPosted: Fri Jan 07, 2011 4:19 am 
Offline

Joined: Fri Sep 11, 2009 8:30 am
Posts: 687
Dingo
???????

Sorry niman and NS1. I wont be commenting on this thread again. It's too important that you guys post the real stuff without the noise.


Top
 Profile  
 
Display posts from previous:  Sort by  
Post new topic Reply to topic  [ 91 posts ]  Go to page Previous  1, 2, 3, 4, 5, 6 ... 10  Next

All times are UTC - 5 hours [ DST ]


Who is online

Users browsing this forum: niman and 57 guests


You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot post attachments in this forum

Search for:
Jump to:  
Powered by phpBB® Forum Software © phpBB Group