Rhiza Labs FluTracker Forum

Yes pandemic H1N1 is following the footsteps of seasonal H1N1

http://precedings.nature.com/documents/2832/version/1

_________________
www.twitter.com/hniman

For Dingo so he can follow it.

So if it follows this path. Tamiflu will become 99.9% USELESS due to the H274Y mutation becoming fixed in P/H1N1 which is now called our seasonal flu.

So that leaves one approved anti-viral left to combat H1N1. We will wait and see if Relenza becomes resistant down the track. We do know 100% that relenza still works effectively on the H274Y H1N1 strain. As seen in the recent study published yesterday.

Clarifucation. Drivers, like S166P and S188T can drive any hitchhiking polymorphism, including D225G.

http://www.youtube.com/watch?v=mvsmRuRp4cM

_________________
www.twitter.com/hniman

From NS1's first post:



And eventually as swine flu becomes the new seasonal flu it will become both milder and resistant to Tamiflu.

Seasonal flu Tamiflu resistance didn't result in massive Relenza sales, did it?

You are now spuiking Relenza in virtually every post. In most forums I've been involved with over the years, you'd be banned for spamming.

As hitchhiking polymorphisms go H274Y seems to be very efficent along with D225 judging by the evidence from these latest sequences.

Seasonal H1N1 H274Y fixing co-incided with Novel Swine flu H1N1 so old seasonal H1N1 was swamped and dominated and didnt exist much anymore. Read up some more.

You have lost the plot now. What forums you talking about !!!

Commentary at

http://www.recombinomics.com/News/01071 ... Clade.html

_________________
www.twitter.com/hniman

All four are on the Ellis Figure3 [1] chart marked as fatality and all four were updated yesterday on GISAID as "Deceased". Two were recent and all four are divergent.

GISAID 2010-12-20 deposited sequences are notated with green boxes on the Ellis Figure3 [1] chart.

UK_2010_Phylo_ELLIS_Fig3new_4_GISAID_Notated.jpg

Fatal Sequences from Ellis Figure 3 In GISAID 2010-12-20 Deposit

• UKWhiteChapel4880374_2M_2010_11_28_f
• UKCambridge118_4F_2010_11_19_f
• UKWhiteChapel4780352_5M_2010_10_26_f
• UKBirmingham3220137_44F_2010_08_07_f

GeneWurx_UK_December_Emerging_Genetics_v3.xls

Hyper-Zoonotic Polymorphism Details

Please excuse the intermediate markings on these sequences. The following are rough lab notes, but divergence may be ascertained easily.

The common ground among these sequences and those in the database on either side of them temporally, especially Iran, is the high quantity of polymorphisms that are novel or rare to pH1N1 and that also appear in zoonotic reservoirs, particularly H3N8, H5N1 and H7N7.

Even small genetic adjustments from animal vectors into human infections, especially H3N8, may create variant behaviour. This potential era of zoonotic sub-segment spillover merits as much investigation for severity (in combination) as does the recognised 225G.

. . . . UKWhiteChapel4880374_2M_2010_11_28_f (
. . . . . . . . 0A (gCC) [1918 (GCT), S7 (GCT), S5 (GCA)]
. . . . . . . . syn55L [S9, H5N1],
. . . . . . . . . . . . . . [Darwin47_2010_08_09 with syn529L,
. . . . . . . . . . . . . . Iran16273_2009_11_22 with 226R
. . . . . . . . . . . . . . NZ_Waikato2_2010_01_04 with 233H,
. . . . . . . . . . . . . . tkOntarioFAV117_1C_2009_12_07 mult domain matches, et al],
. . . . . . . . 188T [H6N1, H7N7],
. . . . . . . . syn338G [H3N8, H4, H5, H6, sw],
. . . . . . . . . . . . . . . [OzBrisbane209_51F_2010_08_09
. . . . . . . . . . . . . . . . . . . . with 156E & 225G,
. . . . . . . . . . . . . . . Arizona05_2010_05_11 with 0A,
. . . . . . . . . . . . . . . Swine Asia 2005 with 0A, et al]
. . . . . . . . 377K,
. . . . . . . . 454N [H7N3, H7N7, H9N2]
. . . . . . . . . . [Florida14_24M_2010_08_05
. . . . . . . . . . . . . . . . . . with 188T, 454N,
. . . . . . . . . . FL_Pen210_2009_11_10
. . . . . . . . . . . . . . . . . . with 225E,
. . . . . . . . . . SouthCarolina18_2009_09_16_VxX
. . . . . . . . . . . . . . . . . . with 159D, 224K, et al],
. . . . . . . . syn529L (CTt) [Unique to PF11]
. . . . . . . . . . . . . . . . . . . . [S7 (CTt), tn with syn338G (GGg)]
. . . . . . . . . . . . . . . . . . . . [PF11 32 Worldwide (CTa),
. . . . . . . . . . . . . . . . . . . . PF11 5 North America (tTG)],
. . . . . . . . . . . . . . . . . . . . [swThailandCU_CHK4_2009_01 (tTG)
. . . . . . . . . . . . . . . . . . . . . . . . . . with 0A, syn338G, 189T, 377G, syn451K, syn456L])

. . . . UKCambridge118_4F_2010_11_19_f (
. . . . . . . . syn118E tcatttgaaaggtttgaA,
. . . . . . . . 137T [MoldovaG170_2009,
. . . . . . . . . . . . . 41 sequences at GISAID],
. . . . . . . . syn163K,
. . . . . . . . 186P,
. . . . . . . . syn251L gaagcaactggaaatctG,
. . . . . . . . syn293L gctataaacaccagcctT,
. . . . . . . . syn363G [21 sequences at GISAID],
. . . . . . . . syn455Q caAttaaaaaacaatgcc ,
. . . . . . . . syn474C [H3N8],
. . . . . . . . 504G ttaaacagagaagaaatagGt,
. . . . . . . . 513V [1918, S5, tn] Gtttaccagattttggcgatc)

. . . . UKWhiteChapel4780352_5M_2010_10_26_f (
. . . . . . . . syn58C,
. . . . . . . . 100N,
. . . . . . . . 128D,
. . . . . . . . syn131S tcaaacaaaggtgtaacggca,
. . . . . . . . syn210S,
. . . . . . . . 377K)

. . . . UKBirmingham3220137_44F_2010_08_07_f (
. . . . . . . . #8A gcagttctgctatatacattt,
. . . . . . . . 175K aaagtcctcgtgctatgg,
. . . . . . . . 311E Gaaagcacaaaattgaga,
. . . . . . . . 377K,
. . . . . . . . syn385V gtCattgaaaagatgaat,
. . . . . . . . syn451K aagaacttatatgaaaaA,
. . . . . . . . syn454S agTcagttaaaaaacaatgcc,
. . . . . . . . syn494E,
. . . . . . . . 537G [S5] tccctgggggcaatcGgt)

1. Ellis J, Galiano M, Pebody R, Lackenby A, Thompson C, Bermingham A, McLean E, Zhao H, Bolotin S, Dar O, Watson JM, Zambon M. Virological analysis of fatal influenza cases in the United Kingdom during the early wave of influenza in winter 2010/11. Euro Surveill. 2011;16(1):pii=19760. Available online: http://www.eurosurveillance.org/ViewArt ... leId=19760

_________________
http://genewurx.com/
Independent Primary Research on Viral Genetics and the
Host-Pathogen Immune Dynamics of Zoonotic Influenza Reservoirs

Who is talking about old seasonal flu? Looks like you have trouble with tenses and comprehension generally. In each pandemic, the new flu becomes "the seasonal flu" as I posted above.

Re forums, I've been on all sorts for nearly decade, including at the Moderator and Administrator level which included banning spammers like you.

Dingo
???????

Sorry niman and NS1. I wont be commenting on this thread again. It's too important that you guys post the real stuff without the noise.