Rhiza Labs FluTracker Forum

The place to discuss the flu
It is currently Sun May 19, 2013 7:49 am

All times are UTC - 5 hours [ DST ]




Post new topic Reply to topic  [ 37 posts ]  Go to page Previous  1, 2, 3, 4
Author Message
PostPosted: Wed Mar 10, 2010 6:17 pm 
Offline

Joined: Fri Jan 08, 2010 3:22 pm
Posts: 5180
Location: East of London
:hello: Many thanks, will look at more closely tomorrow.

_________________
Praemonitus, Praemunitus..Forewarned is Forearmed.


Top
 Profile  
 
PostPosted: Wed Mar 10, 2010 6:24 pm 
Online

Joined: Wed Aug 19, 2009 10:42 am
Posts: 27279
Location: Pittsburgh, PA USA
niman wrote:
stephensons wrote:
Quote:
Just copy and paste the nucleotide sequence into the BLAST search box

http://blast.ncbi.nlm.nih.gov/Blast.cgi

Select "other" database and when you get the result, chose display with "query anchored and dots for match" and new polymorphisms, including A716G will be obvious.



I am doing something wrong, here's what I've done so far:

Basic Blast, then go to Nucleotide Blast, Enter Query Sequence (copy and pasted A/Thessaloniki/225/2010 (H1N1). Run Blast, came up with Graphic Summary/Colour key alignment scores and that's as far as I got. It's a bit confusing.


After the blast there should be a graphic summary and below the graphic summary there are descriptions, and below the descriptions there are alignments.

If you go to the top and click on "formatting options" and unclick "Advanced view" and use the pull down menu for "Alignment View" and select "Query-anchored with dots for identities" and then click on the "Reformat" button, and go down the page, the aligniment view should have the first 60 nucleotides which are labeled "Query". The default is the top 100 matches, so there should be 100 rows which are primarily dots, because each of the top 100 will be isolates that match most of the 60 positions.
If you go down further you will see the next 60 positions. For the above sequence, you won't see a column of letters until you get to the 11th set, which will start with query position 661. Query position 665 has a "G" and the top 8 sequences will have a dot (because they also have a "G"), and most of the next 94 lines will have an "A" (but there are four more which will have a dot). Thus, for position 661 in the query, there are 12 sequences that match A/Thessaloniki/225/2010 including A/Thessaloniki/225/2010 which is at the top of the dot list (query position 665 corresponds to position 715 in HA). The name of the "match" can be seen by clicking on the accession number to the left of the 60 dots. All of those sequences will also have A716G which codes for D225G.
The sequence you chose has A716G as its only change, so if you go to the end of the sequences, you will just see more dots.

Thus, the above sequence has 981 nucleotides, and there is only one difference with the consensus sequence and that difference is A716G, which codes for D225G.

The query set starting with position 661 will look like this (but will be formatted better and the accession numbers will be active links to the charcterization page for each):

Query 661 AGGGGTCAAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGGGAGACAAAATA 720
CY056316 661 ............................................................ 720
CY056306 661 ............................................................ 720
CY056299 661 ............................................................ 720
CY054280 712 ............................................................ 771
CY053907 712 ............................................................ 771
GQ915017 712 ............................................................ 771
GQ200237 712 ............................................................ 771
GQ160568 712 ............................................................ 771
CY056340 661 ....A....................................................... 720
CY056339 661 ....A....................................................... 720
CY056338 661 ....A....................................................... 720
CY056337 661 ....A....................................................... 720
CY056336 661 ....A....................................................... 720
CY056335 661 ....A....................................................... 720
CY056334 661 ....A....................................................... 720
CY056331 661 ....A....................................................... 720
CY056330 661 ....A....................................................... 720
CY056328 661 ....A....................................................... 720
CY056327 661 ....A....................................................... 720
CY056326 661 ....A....................................................... 720
CY056319 661 ....A....................................................... 720
CY056315 661 ....A....................................................... 720
CY056314 661 ....A....................................................... 720
CY056313 661 ....A....................................................... 720
CY056308 661 ....A....................................................... 720
CY056305 661 ....A....................................................... 720
CY055479 712 ....A....................................................... 771
CY056204 725 ....A....................................................... 784
CY056196 712 ....A....................................................... 771
CY056188 712 ....A....................................................... 771
CY056132 712 ....A....................................................... 771
CY056028 725 ....A....................................................... 784
CY056012 725 ....A....................................................... 784
CY055948 725 ....A....................................................... 784
CY055772 725 ....A....................................................... 784
CY055764 725 ....A....................................................... 784
CY055684 725 ....A....................................................... 784
CY055597 725 ....A....................................................... 784
CY055565 725 ....A....................................................... 784
CY055518 712 ....A....................................................... 771
CY055471 712 ....A....................................................... 771
CY055455 725 ....A....................................................... 784
CY055423 725 ....A....................................................... 784
CY055303 744 ....A....................................................... 803
CY055256 712 ....A....................................................... 771
CY055252 712 ....A....................................................... 771
CY055244 712 ....A....................................................... 771
CY055236 712 ....A....................................................... 771
CY055226 712 ....A....................................................... 771
CY055210 712 ....A....................................................... 771
CY055208 712 ....A....................................................... 771
CY055206 712 ....A....................................................... 771
CY055202 712 ....A....................................................... 771
CY055196 712 ....A....................................................... 771
GU585410 661 ....A....................................................... 720
GU576542 712 ....A....................................................... 771
GU562458 732 ............................................................ 791
CY055059 725 ....A....................................................... 784
CY055043 725 ....A....................................................... 784
CY055035 725 ....A....................................................... 784
CY055027 725 ....A....................................................... 784
CY055019 725 ....A....................................................... 784
CY055003 712 ....A....................................................... 771
CY054995 725 ....A....................................................... 784
CY054987 712 ....A....................................................... 771
CY054971 725 ....A....................................................... 784
CY054955 725 ....A....................................................... 784
CY054923 725 ....A....................................................... 784
CY054915 725 ....A....................................................... 784
CY054811 725 ............................................................ 784
CY054803 725 ....A....................................................... 784
CY054787 725 ....A....................................................... 784
CY054747 725 ....A....................................................... 784
CY054739 712 ....A....................................................... 771
GU480938 732 ............................................................ 791
GU470879 712 ....A....................................................... 771
GU451254 730 ............................................................ 789
GU433033 732 ....A....................................................... 791
CY054282 712 ....A....................................................... 771
GU369654 762 ....A....................................................... 821
CY053971 712 ....A....................................................... 771
CY053968 712 ....A....................................................... 771
CY053965 712 ....A....................................................... 771
CY053956 712 ....A....................................................... 771
CY053947 712 ....A....................................................... 771
CY053945 712 ....A....................................................... 771
CY053942 712 ....A....................................................... 771
CY053939 712 ....A....................................................... 771
CY053936 712 ....A....................................................... 771
CY053933 712 ....A....................................................... 771
CY053913 712 ....A....................................................... 771
CY053910 712 ....A....................................................... 771
CY053901 712 ....A....................................................... 771
CY053896 712 ....A....................................................... 771
CY053506 744 ....A....................................................... 803
CY053498 744 ....A....................................................... 803
CY053490 744 ....A....................................................... 803
CY053482 744 ....A....................................................... 803
CY055218 712 ....A....................................................... 771
CY055214 712 ....A....................................................... 771

_________________
www.twitter.com/hniman


Top
 Profile  
 
PostPosted: Wed Mar 10, 2010 6:29 pm 
Online

Joined: Wed Aug 19, 2009 10:42 am
Posts: 27279
Location: Pittsburgh, PA USA
niman wrote:
stephensons wrote:
Quote:

I am doing something wrong, here's what I've done so far:

Basic Blast, then go to Nucleotide Blast, Enter Query Sequence (copy and pasted A/Thessaloniki/225/2010 (H1N1). Run Blast, came up with Graphic Summary/Colour key alignment scores and that's as far as I got. It's a bit confusing.


After the blast there should be a graphic summary and below the graphic summary there are descriptions, and below the descriptions there are alignments.

If you go to the top and click on "formatting options" and unclick "Advanced view" and use the pull down menu for "Alignment View" and select "Query-anchored with dots for identities" and then click on the "Reformat" button, and go down the page, the aligniment view should have the first 60 nucleotides which are labeled "Query". The default is the top 100 matches, so there should be 100 rows which are primarily dots, because each of the top 100 will be isolates that match most of the 60 positions.
If you go down further you will see the next 60 positions. For the above sequence, you won't see a column of letters until you get to the 11th set, which will start with query position 661. Query position 665 has a "G" and the top 8 sequences will have a dot (because they also have a "G"), and most of the next 94 lines will have an "A" (but there are four more which will have a dot). Thus, for position 661 in the query, there are 12 sequences that match A/Thessaloniki/225/2010 including A/Thessaloniki/225/2010 which is at the top of the dot list (query position 665 corresponds to position 715 in HA). The name of the "match" can be seen by clicking on the accession number to the left of the 60 dots. All of those sequences will also have A716G which codes for D225G.
The sequence you chose has A716G as its only change, so if you go to the end of the sequences, you will just see more dots.

Thus, the above sequence has 981 nucleotides, and there is only one difference with the consensus sequence and that difference is A716G, which codes for D225G.

The query set starting with position 661 will look like this (but will be formatted better and the accession numbers will be active links to the charcterization page for each):

Query 661 AGGGGTCAAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGGGAGACAAAATA 720
CY056316 661 ............................................................ 720
CY056306 661 ............................................................ 720
CY056299 661 ............................................................ 720
CY054280 712 ............................................................ 771
CY053907 712 ............................................................ 771
GQ915017 712 ............................................................ 771
GQ200237 712 ............................................................ 771
GQ160568 712 ............................................................ 771
CY056340 661 ....A....................................................... 720
CY056339 661 ....A....................................................... 720
CY056338 661 ....A....................................................... 720
CY056337 661 ....A....................................................... 720
CY056336 661 ....A....................................................... 720
CY056335 661 ....A....................................................... 720
CY056334 661 ....A....................................................... 720
CY056331 661 ....A....................................................... 720
CY056330 661 ....A....................................................... 720
CY056328 661 ....A....................................................... 720
CY056327 661 ....A....................................................... 720
CY056326 661 ....A....................................................... 720
CY056319 661 ....A....................................................... 720
CY056315 661 ....A....................................................... 720
CY056314 661 ....A....................................................... 720
CY056313 661 ....A....................................................... 720
CY056308 661 ....A....................................................... 720
CY056305 661 ....A....................................................... 720
CY055479 712 ....A....................................................... 771
CY056204 725 ....A....................................................... 784
CY056196 712 ....A....................................................... 771
CY056188 712 ....A....................................................... 771
CY056132 712 ....A....................................................... 771
CY056028 725 ....A....................................................... 784
CY056012 725 ....A....................................................... 784
CY055948 725 ....A....................................................... 784
CY055772 725 ....A....................................................... 784
CY055764 725 ....A....................................................... 784
CY055684 725 ....A....................................................... 784
CY055597 725 ....A....................................................... 784
CY055565 725 ....A....................................................... 784
CY055518 712 ....A....................................................... 771
CY055471 712 ....A....................................................... 771
CY055455 725 ....A....................................................... 784
CY055423 725 ....A....................................................... 784
CY055303 744 ....A....................................................... 803
CY055256 712 ....A....................................................... 771
CY055252 712 ....A....................................................... 771
CY055244 712 ....A....................................................... 771
CY055236 712 ....A....................................................... 771
CY055226 712 ....A....................................................... 771
CY055210 712 ....A....................................................... 771
CY055208 712 ....A....................................................... 771
CY055206 712 ....A....................................................... 771
CY055202 712 ....A....................................................... 771
CY055196 712 ....A....................................................... 771
GU585410 661 ....A....................................................... 720
GU576542 712 ....A....................................................... 771
GU562458 732 ............................................................ 791
CY055059 725 ....A....................................................... 784
CY055043 725 ....A....................................................... 784
CY055035 725 ....A....................................................... 784
CY055027 725 ....A....................................................... 784
CY055019 725 ....A....................................................... 784
CY055003 712 ....A....................................................... 771
CY054995 725 ....A....................................................... 784
CY054987 712 ....A....................................................... 771
CY054971 725 ....A....................................................... 784
CY054955 725 ....A....................................................... 784
CY054923 725 ....A....................................................... 784
CY054915 725 ....A....................................................... 784
CY054811 725 ............................................................ 784
CY054803 725 ....A....................................................... 784
CY054787 725 ....A....................................................... 784
CY054747 725 ....A....................................................... 784
CY054739 712 ....A....................................................... 771
GU480938 732 ............................................................ 791
GU470879 712 ....A....................................................... 771
GU451254 730 ............................................................ 789
GU433033 732 ....A....................................................... 791
CY054282 712 ....A....................................................... 771
GU369654 762 ....A....................................................... 821
CY053971 712 ....A....................................................... 771
CY053968 712 ....A....................................................... 771
CY053965 712 ....A....................................................... 771
CY053956 712 ....A....................................................... 771
CY053947 712 ....A....................................................... 771
CY053945 712 ....A....................................................... 771
CY053942 712 ....A....................................................... 771
CY053939 712 ....A....................................................... 771
CY053936 712 ....A....................................................... 771
CY053933 712 ....A....................................................... 771
CY053913 712 ....A....................................................... 771
CY053910 712 ....A....................................................... 771
CY053901 712 ....A....................................................... 771
CY053896 712 ....A....................................................... 771
CY053506 744 ....A....................................................... 803
CY053498 744 ....A....................................................... 803
CY053490 744 ....A....................................................... 803
CY053482 744 ....A....................................................... 803
CY055218 712 ....A....................................................... 771
CY055214 712 ....A....................................................... 771

The names of the top 100 are in the description, which also has the accession numbers. The top 8 have no differences with the query and also have D225G as the only change from the consensus.


gb|CY056316.1| Influenza A virus(A/Thessaloniki/2502/2009(H1N... 1945 0.0
gb|CY056306.1| Influenza A virus(A/Thessaloniki/225/2010(H1N1... 1945 0.0
gb|CY056299.1| Influenza A virus(A/Thessaloniki/206/2010(H1N1... 1945 0.0
gb|CY054280.1| Influenza A virus (A/Rio de Janeiro/5826/2009(... 1945 0.0
gb|CY053907.1| Influenza A virus (A/Argentina/HNRG16/2009(H1N... 1945 0.0
gb|GQ915017.1| Influenza A virus (A/Sao Paulo/53206/2009(H1N1... 1945 0.0
gb|GQ200237.1| Influenza A virus (A/Georgia/01/2009(H1N1)) se... 1945 0.0
gb|GQ160568.1| Influenza A virus (A/New York/04/2009(H1N1)) s... 1945 0.0
gb|CY056340.1| Influenza A virus(A/Kerkira/985/2009(H1N1)) se... 1937 0.0
gb|CY056339.1| Influenza A virus(A/Thessaloniki/787/2009(H1N1... 1937 0.0
gb|CY056338.1| Influenza A virus(A/Thessaloniki/690/2009(H1N1... 1937 0.0
gb|CY056337.1| Influenza A virus(A/Thessaloniki/449/2009(H1N1... 1937 0.0
gb|CY056336.1| Influenza A virus(A/Thessaloniki/434/2009(H1N1... 1937 0.0
gb|CY056335.1| Influenza A virus(A/Thessaloniki/4184/2009(H1N... 1937 0.0
gb|CY056334.1| Influenza A virus(A/Thessaloniki/4183/2009(H1N... 1937 0.0
gb|CY056331.1| Influenza A virus(A/Thessaloniki/366/2009(H1N1... 1937 0.0
gb|CY056330.1| Influenza A virus(A/Thessaloniki/3089/2009(H1N... 1937 0.0
gb|CY056328.1| Influenza A virus(A/Thesssaloniki/2904/2009(H1... 1937 0.0
gb|CY056327.1| Influenza A virus(A/Thessaloniki/2856/2009(H1N... 1937 0.0
gb|CY056326.1| Influenza A virus(A/Thessaloniki/2840/2009(H1N... 1937 0.0
gb|CY056319.1| Influenza A virus(A/Thessaloniki/2681/2009(H1N... 1937 0.0
gb|CY056315.1| Influenza A virus(A/Kastoria/245/2010(H1N1)) s... 1937 0.0
gb|CY056314.1| Influenza A virus(A/Thessaloniki/2445/2009(H1N... 1937 0.0
gb|CY056313.1| Influenza A virus(A/Katerini/240/2010(H1N1)) s... 1937 0.0
gb|CY056308.1| Influenza A virus(A/Thessaloniki/2331/2009(H1N... 1937 0.0
gb|CY056305.1| Influenza A virus(A/Thessaloniki/2228/2009(H1N... 1937 0.0
gb|CY055479.1| Influenza A virus (A/California/VRDL72/2009(H1... 1937 0.0
gb|CY056204.1| Influenza A virus (A/San Diego/INS52/2009(H1N1... 1937 0.0
gb|CY056196.1| Influenza A virus (A/San Diego/INS48/2009(H1N1... 1937 0.0
gb|CY056188.1| Influenza A virus (A/District of Columbia/INS4... 1937 0.0
gb|CY056132.1| Influenza A virus (A/San Diego/INS34/2009(H1N1... 1937 0.0
gb|CY056028.1| Influenza A virus (A/San Diego/INS16/2009(H1N1... 1937 0.0
gb|CY056012.1| Influenza A virus (A/San Diego/INS11/2009(H1N1... 1937 0.0
gb|CY055948.1| Influenza A virus (A/San Diego/INS01/2009(H1N1... 1937 0.0
gb|CY055772.1| Influenza A virus (A/Australia/48/2009(H1N1)) ... 1937 0.0
gb|CY055764.1| Influenza A virus (A/Australia/47/2009(H1N1)) ... 1937 0.0
gb|CY055684.1| Influenza A virus (A/Australia/32/2009(H1N1)) ... 1937 0.0
gb|CY055597.1| Influenza A virus (A/Australia/16/2009(H1N1)) ... 1937 0.0
gb|CY055565.1| Influenza A virus (A/Australia/12/2009(H1N1)) ... 1937 0.0
gb|CY055518.1| Influenza A virus (A/California/VRDL78/2009(H1... 1937 0.0
gb|CY055471.1| Influenza A virus (A/California/VRDL18/2009(H1... 1937 0.0
gb|CY055455.1| Influenza A virus (A/California/VRDL12/2009(H1... 1937 0.0
gb|CY055423.1| Influenza A virus (A/New York/4887/2009(H1N1))... 1937 0.0
gb|CY055303.1| Influenza A virus (A/Singapore/GN285/2009(H1N1... 1937 0.0
gb|CY055256.1| Influenza A virus (A/Malaysia/9147/2009(H1N1))... 1937 0.0
gb|CY055252.1| Influenza A virus (A/Malaysia/9118/2009(H1N1))... 1937 0.0
gb|CY055244.1| Influenza A virus (A/Malaysia/5286/2009(H1N1))... 1937 0.0
gb|CY055236.1| Influenza A virus (A/Malaysia/5270/2009(H1N1))... 1937 0.0
gb|CY055226.1| Influenza A virus (A/Malaysia/5225/2009(H1N1))... 1937 0.0
gb|CY055210.1| Influenza A virus (A/Malaysia/5103/2009(H1N1))... 1937 0.0
gb|CY055208.1| Influenza A virus (A/Malaysia/5057/2009(H1N1))... 1937 0.0
gb|CY055206.1| Influenza A virus (A/Malaysia/5027/2009(H1N1))... 1937 0.0
gb|CY055202.1| Influenza A virus (A/Malaysia/4737/2009(H1N1))... 1937 0.0
gb|CY055196.1| Influenza A virus (A/Malaysia/3758/2009(H1N1))... 1937 0.0
gb|GU585410.1| Influenza A virus (A/Roma/ISS22/2009(H1N1)) se... 1937 0.0
gb|GU576542.1| Influenza A virus (A/Ancona/01/2010(H1N1)) seg... 1937 0.0
gb|GU562458.1| Influenza A virus (A/Karasuk/01/2010(H1N1)) se... 1937 0.0
gb|CY055059.1| Influenza A virus (A/Australia/3/2009(H1N1)) s... 1937 0.0
gb|CY055043.1| Influenza A virus (A/California/VRDL70/2009(H1... 1937 0.0
gb|CY055035.1| Influenza A virus (A/California/VRDL69/2009(H1... 1937 0.0
gb|CY055027.1| Influenza A virus (A/California/VRDL68/2009(H1... 1937 0.0
gb|CY055019.1| Influenza A virus (A/California/VRDL67/2009(H1... 1937 0.0
gb|CY055003.1| Influenza A virus (A/California/VRDL64/2009(H1... 1937 0.0
gb|CY054995.1| Influenza A virus (A/California/VRDL61/2009(H1... 1937 0.0
gb|CY054987.1| Influenza A virus (A/California/VRDL58/2009(H1... 1937 0.0
gb|CY054971.1| Influenza A virus (A/California/VRDL53/2009(H1... 1937 0.0
gb|CY054955.1| Influenza A virus (A/California/VRDL51/2009(H1... 1937 0.0
gb|CY054923.1| Influenza A virus (A/California/VRDL43/2009(H1... 1937 0.0
gb|CY054915.1| Influenza A virus (A/California/VRDL41/2009(H1... 1937 0.0
gb|CY054811.1| Influenza A virus (A/California/VRDL27/2009(H1... 1937 0.0
gb|CY054803.1| Influenza A virus (A/California/VRDL26/2009(H1... 1937 0.0
gb|CY054787.1| Influenza A virus (A/California/VRDL23/2009(H1... 1937 0.0
gb|CY054747.1| Influenza A virus (A/California/VRDL9/2009(H1N... 1937 0.0
gb|CY054739.1| Influenza A virus (A/California/VRDL8/2009(H1N... 1937 0.0
gb|GU480938.1| Influenza A virus (A/Tomsk/08/2009(H1N1)) segm... 1937 0.0
gb|GU470879.1| Influenza A virus (A/swine/Indiana/27007/2009(... 1937 0.0
gb|GU451254.1| Influenza A virus (A/Tver/IIV2969/2009(H1N1)) ... 1937 0.0
gb|GU433033.1| Influenza A virus (A/Novosibirsk/02/2009(H1N1)... 1937 0.0
gb|CY054282.1| Influenza A virus (A/Rio Grande do Sul/7108/20... 1937 0.0
gb|GU369654.1| Influenza A virus (A/Ankara/10/2009(H1N1)) seg... 1937 0.0
gb|CY053971.1| Influenza A virus (A/Argentina/HNRG5/2009(H1N1... 1937 0.0
gb|CY053968.1| Influenza A virus (A/Argentina/HNRG48/2009(H1N... 1937 0.0
gb|CY053965.1| Influenza A virus (A/Argentina/HNRG45/2009(H1N... 1937 0.0
gb|CY053956.1| Influenza A virus (A/Argentina/HNRG41/2009(H1N... 1937 0.0
gb|CY053947.1| Influenza A virus (A/Argentina/HNRG37/2009(H1N... 1937 0.0
gb|CY053945.1| Influenza A virus (A/Argentina/HNRG36/2009(H1N... 1937 0.0
gb|CY053942.1| Influenza A virus (A/Argentina/HNRG33/2009(H1N... 1937 0.0
gb|CY053939.1| Influenza A virus (A/Argentina/HNRG32/2009(H1N... 1937 0.0
gb|CY053936.1| Influenza A virus (A/Argentina/HNRG31/2009(H1N... 1937 0.0
gb|CY053933.1| Influenza A virus (A/Argentina/HNRG30/2009(H1N... 1937 0.0
gb|CY053913.1| Influenza A virus (A/Argentina/HNRG18/2009(H1N... 1937 0.0
gb|CY053910.1| Influenza A virus (A/Argentina/HNRG17/2009(H1N... 1937 0.0
gb|CY053901.1| Influenza A virus (A/Argentina/HNRG14/2009(H1N... 1937 0.0
gb|CY053896.1| Influenza A virus (A/Argentina/HNRG13/2009(H1N... 1937 0.0
gb|CY053506.1| Influenza A virus (A/Taiwan/206/2009(H1N1)) se... 1937 0.0
gb|CY053498.1| Influenza A virus (A/Taiwan/177/2009(H1N1)) se... 1937 0.0
gb|CY053490.1| Influenza A virus (A/Taiwan/167/2009(H1N1)) se... 1937 0.0
gb|CY053482.1| Influenza A virus (A/Taiwan/156/2009(H1N1)) se... 1937 0.0
gb|CY055218.1| Influenza A virus (A/Malaysia/5175/2009(H1N1))... 1933 0.0
gb|CY055214.1| Influenza A virus (A/Malaysia/5162/2009(H1N1))... 1933 0.0

_________________
www.twitter.com/hniman


Last edited by niman on Wed Mar 10, 2010 7:53 pm, edited 1 time in total.

Top
 Profile  
 
PostPosted: Wed Mar 10, 2010 6:37 pm 
Online

Joined: Wed Aug 19, 2009 10:42 am
Posts: 27279
Location: Pittsburgh, PA USA
stephensons wrote:
Quote:
Just copy and paste the nucleotide sequence into the BLAST search box

http://blast.ncbi.nlm.nih.gov/Blast.cgi

Select "other" database and when you get the result, chose display with "query anchored and dots for match" and new polymorphisms, including A716G will be obvious.



I am doing something wrong, here's what I've done so far:

Basic Blast, then go to Nucleotide Blast, Enter Query Sequence (copy and pasted A/Thessaloniki/225/2010 (H1N1). Run Blast, came up with Graphic Summary/Colour key alignment scores and that's as far as I got. It's a bit confusing.

Be sure to select "others" database before clicking on BLAST button (the default is a human database, followed my mouse database - neither have viral sequences).

PS, Anyone can try this at home!

_________________
www.twitter.com/hniman


Top
 Profile  
 
PostPosted: Wed Mar 10, 2010 7:22 pm 
Offline

Joined: Sun Oct 11, 2009 4:44 pm
Posts: 510
:dizzy:

Thanks for the 101 lessons


Top
 Profile  
 
PostPosted: Wed Mar 10, 2010 7:59 pm 
Offline

Joined: Thu Nov 19, 2009 10:38 pm
Posts: 17
Note to self: Figure out how to do this (muttering to myself "I think I can, I think I can, I think ....")

_________________
http://deanb2001.wordpress.com


Top
 Profile  
 
PostPosted: Wed Mar 10, 2010 8:02 pm 
Online

Joined: Wed Aug 19, 2009 10:42 am
Posts: 27279
Location: Pittsburgh, PA USA
Dean B wrote:
Note to self: Figure out how to do this (muttering to myself "I think I can, I think I can, I think ....")

It really isn't that hard. It's copy paste and a couple of mouse clicks. Takes a few seconds.

_________________
www.twitter.com/hniman


Top
 Profile  
 
Display posts from previous:  Sort by  
Post new topic Reply to topic  [ 37 posts ]  Go to page Previous  1, 2, 3, 4

All times are UTC - 5 hours [ DST ]


Who is online

Users browsing this forum: Dingo, ichiro [Crawler], niman, psbot [Picsearch] and 27 guests


You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot post attachments in this forum

Search for:
Jump to:  
Powered by phpBB® Forum Software © phpBB Group