Rhiza Labs FluTracker Forum

The place to discuss the flu
It is currently Sat May 25, 2013 7:38 pm

All times are UTC - 5 hours [ DST ]




Post new topic Reply to topic  [ 286 posts ]  Go to page Previous  1, 2, 3, 4, 5, 6, 7 ... 29  Next
Author Message
 Post subject: Re: flu-A evolution
PostPosted: Sun Nov 01, 2009 4:16 am 
Offline
User avatar

Joined: Tue Sep 01, 2009 11:54 pm
Posts: 1785
Location: germany
so any new introductions from birds into mammals
after decades of evolution in mammals would
introduce "ancient" amino-acids.

"Correcting" the driving away from the universal,
superior(at least in birds) index-strain

_________________
no patents on genes, publish the GISAID sequences !


Top
 Profile  
 
 Post subject: Re: flu-A evolution
PostPosted: Sun Nov 01, 2009 11:04 am 
Offline
User avatar

Joined: Wed Aug 26, 2009 4:15 pm
Posts: 623
I just read your last posts, so I need some extra time to ponder your statements!

I feel the whole idea of avian influenza as a reference biologically sound.
The vast live avian viruses "genetic database", which "seeds" mammalian influenza, as you once putted, with a preserved universal "template".

Most textbooks illustrations place avian on the center of influenza ecology.
Attachment:
Flu_eco_resrvoir.jpg
Flu_eco_resrvoir.jpg [ 27.59 KiB | Viewed 790 times ]

FIGURE 48.1 Influenza A virus reservoir. Wild aquatic birds are the main reservoir of influenza A viruses. Virus transmission has been reported from wild waterfowl to poultry, sea mammals, pigs, horses, and humans. Viruses are also transmitted between pigs and humans, and from poultry to humans. Equine influenza viruses have recently been transmitted to dogs.(1)

There is a fragment of our earlier discussion that deserves clarification:

Quote:
> The larger S/N could possibly be explained by different evolution stages
> on avian and mammal hosts. Only nonsynonymous mutations change the resulting RNA
> amino acid expression and, as a consequence, the whole biochemical expression of the
> resulting virions.

yes, but I think it's not about the host evolution. Fla-A evolves in birds, only accidently
it goes to mammals. It should be adapted better to birds and thus evolve with
larger diversity in birds, also on the amino-acid level
.

I’m not sure my redaction was clear to point that influenza virus are a different stages of evolution on avian x mammalian hosts. I meant virus evolution on different hosts (and not host evolution). Maybe I am redundant, but I wanted to be sure.

This view is entirely coherent with your remark that “Fla-A evolves in birds, only accidently
it goes to mammals.” The influenza "epicenter" is avian, and mammals infection (human included), a less frequent "genetic incursion".

In the case of pandemic H1N1, a number of avian genes already “seeded” on swine strains during past decades. I am not sure we should assume these introductions from to mammalian are necessarily as a “correction” to a “superior” (best fitted) gene collection. The improved “fitnes” exhibited by older genes could be also attributed to human lack of specific immunity.

(1) Orthomyxoviruses, Peter F. Wright, Gabriele Neumann and Yoshihiro Kawaoka


Last edited by neuromedia on Sun Nov 01, 2009 12:29 pm, edited 1 time in total.

Top
 Profile  
 
 Post subject: Re: flu-A evolution
PostPosted: Sun Nov 01, 2009 12:24 pm 
Offline
User avatar

Joined: Tue Sep 01, 2009 11:54 pm
Posts: 1785
Location: germany
... and mammals seem to be a dead end for the flu.
It doesn't go back to birds.
Well, maybe it did in the past. The world for (human?) flu
dramatically changed with human traveling advances.
Before that it seems that there was not so much flu in humans
or/and it had used other methods to travel. (horses ?)

Anyway, that's not really needed since there are still birds
to infect.

However, once in a "while" it happens that flu stays in
mammals and survives. That while was some thousand years
ago, when flu-B emerged/separated.
It didn't go back to birds.
A/Eq/Prague/1956 is also rather distant, not from the
avian "index" (_if_ this index-theory proves right)
Another "flu-B" for horses, but maybe dead now.

The avian index could be more fit, established in millenia,
not just decades/centuries as with human flu,
and when human fla-A drifts away from it,
then some injections with avian segments
make it better again.

In 1918 and preceding years it may have been a more dramatical
injection, all 8 segments. No remains from human flu
before 1918 are known.

The Prague-virus maybe once infected humans,
or it was from the avian index also before 1918 ?
Prague-->index would have been a big,
dramatical step.

_________________
no patents on genes, publish the GISAID sequences !


Top
 Profile  
 
 Post subject: Re: flu-A evolution
PostPosted: Sun Nov 01, 2009 12:30 pm 
Offline
User avatar

Joined: Tue Sep 01, 2009 11:54 pm
Posts: 1785
Location: germany
the idea with different "stages" looks not so plausible to me currently.

Human flu evolves away from 1918 permanently and continuously on the amino-acid level.
Avian flu not, or much slower.
But when the same segment jumps to humans, then it speeds up again.

How can the same virus be at different stages in humans and birds ?

No indication that it reaches a common "index" in mammals.

_________________
no patents on genes, publish the GISAID sequences !


Top
 Profile  
 
 Post subject: Re: flu-A evolution
PostPosted: Sun Nov 01, 2009 1:51 pm 
Offline
User avatar

Joined: Wed Aug 26, 2009 4:15 pm
Posts: 623
I have to admit the idea could sound close to a paradox. Maybe the expression I coined, “evolutionary stage”, is not a good choice and should be rephrased.

Human flu evolves away from 1918 permanently and continuously on the amino-acid level, as you putted. I agree (what’s more, that’s what sequences data demonstrate). Human influenza does not appear to converge to any common “index”. It looks more like a “dead end”.

What if old 1918 H1N1, “pacified” by decades of human host existence, did not receive avian genes contribution from time to time? Neither 1957 nor 1968 pandemics would occur. What future (if any) would possibly be reserved to old seasonal H1N1?

The avian condition of gene donors to mammals is a one-way route. The influenza relationship with humans (mammalian) is different from avian hosts. Maybe “evolutionary regimes” could be a little better. “Stasis” proved not good enough to birds. Any alternative nomenclature suggestion is welcome!


Last edited by neuromedia on Sun Nov 01, 2009 3:29 pm, edited 1 time in total.

Top
 Profile  
 
 Post subject: Re: flu-A evolution
PostPosted: Sun Nov 01, 2009 2:21 pm 
Offline
User avatar

Joined: Wed Aug 26, 2009 4:15 pm
Posts: 623
A stated on earlier post, I identify your data reveals TWO distinct evolutionary features :

1. The nucleotide substitution rates (synonymous+nonsynonymous) are remarkable lower on avian than mammalian influenza genes.

2. The average (S/N) ratio (synonymous/nonsynonymous) is also quite distinct for avian a mammalian hosts.

I think each of them require a distinct explanation. We have been mainly discussing the feature #2, which I believe to be liked to evolutionary pressure.

I think that feature # 1, slower nucleotide substitution rates could be related to host methabolic and biological host differences. Note that such reasoning almostly excludes standard “random mutations” hypothesis as a decisive factor on influenza evolution.(*)

(*) Assuming random SNP caused by background ionizing radiation and/or cosmic rays, there is a narrow place to host-specific nucleotide mutation rates.


Last edited by neuromedia on Sun Nov 01, 2009 3:52 pm, edited 1 time in total.

Top
 Profile  
 
 Post subject: Re: flu-A evolution
PostPosted: Sun Nov 01, 2009 2:33 pm 
Offline
User avatar

Joined: Tue Sep 01, 2009 11:54 pm
Posts: 1785
Location: germany
usually - in humans or with nucleotides in birds - when you try to find the
one progenitor of a set of sequences, you just take the average of those sequences.
At each position (~2100 nucleotide-positions, ~700 amino-acid-positions) you take
the one nucleotide or amino-acid which occurs most often in that set.
Take care, that the set isn't too much biased by one family. To avoid this : remove all sequences
which are closer than 1% to another sequence already in the set.

This assumes a progenitor and then everything evolves away from it in a circle,sphere,
2100-dimensional sphere. The index, the progenitor in the center and the evolving children
on the circumference, expanding with time.

But on birds with amino-acids that center is occupied by recent sequences !

E.g. A/Ck/Netherlands/1/2003 in PB1 is only 1 amino-acid away from
the calculated progenitor=index=center. (many other examples)

But it is from 2003 and the progenitor should be from ~1850 or 1800 or such.
And it is close to the center in most(all?) of the 11 proteins made from the 8 segments.

----------------
my best central virus: (PB2,PB1,PA,NP,M1)
A/Dk/Altai/1285/1991/08/15(H5N3)

with only 1,1,0,3,2 amino-acid differences to the calculated center
in PB2,PB1,PA,NP,M1

_________________
no patents on genes, publish the GISAID sequences !


Top
 Profile  
 
 Post subject: Re: flu-A evolution
PostPosted: Sun Nov 01, 2009 3:46 pm 
Offline
User avatar

Joined: Wed Aug 26, 2009 4:15 pm
Posts: 623
gsgs wrote:
This assumes a progenitor and then everything evolves away from it in a circle,sphere,2100-dimensional sphere. The index, the progenitor in the center and the evolving children on the circumference, expanding with time.

But on birds with amino-acids that center is occupied by recent sequences !

Does it mean that the children 2100-dimensional sphere does not expand in time at all? (or "radius" expands within a very small range?).


Top
 Profile  
 
 Post subject: Re: flu-A evolution
PostPosted: Sun Nov 01, 2009 3:59 pm 
Offline
User avatar

Joined: Tue Sep 01, 2009 11:54 pm
Posts: 1785
Location: germany
I'll have to check this more closely ... do some statistics and graphics ...
but it seems that with avian amino-acid evolution we do have
no sphere at all. Points distributed in a 2100-dimensional ball,
bigger density in the center.

Other than with avain flu nucleotide-evolution
human-flu nucleotide evolution
human flu amino-acid evolution

_________________
no patents on genes, publish the GISAID sequences !


Top
 Profile  
 
 Post subject: Re: flu-A evolution
PostPosted: Sun Nov 01, 2009 4:03 pm 
Offline
User avatar

Joined: Tue Sep 01, 2009 11:54 pm
Posts: 1785
Location: germany
here an example.
350 nucleotide differences
but only 4 amino-acid differences



Code:

>A/pintail/Alaska/779/2005/08/20(H3N8)  segment 1
ATGGAAAGAATAAAAGAACTAAGAGATCTAATGTCACAGTCTCGCACTCGCGAGATACTAACCAAAACCACTGTGGACCACATGGCCATAATCAAAAAATACACATCAGGAAGGCAAGAGAAGAACCCCGCACTCAGGATGAAGTGGATGATGGCAATGAAGTACCCAATTACAGCAGATAAAAGAATAATGGAAATGATTCCCGAAAGAAATGAACAAGGACAAACCCTCTGGAGCAAAACAAACGATGCCGGCTCAGACCGGGTGATGGTGTCACCTCTAGCTGTAACATGGTGGAATAGGAATGGACCAACAACAAGTACAGTTCACTACCCAAAGGTATATAAAACTTATTTCGAAAAAGTCGAAAGATTGAAACACGGGACCTTTGGCCCTGTCCACTTCAGAAATCAAGTTAAGATAAGACGGAGGGTTGACATAAACCCTGGTCATGCAGATCTCAGTGCCAAAGAGGCACAGGATGTAATCATGGAAGTTGTTTTCCCAAATGAAGTGGGAGCTAGGATACTAACATCGGAATCACAGCTGACAATAACAAAAGAGAAAAAAGAGGAGCTCCAAGACTGCAAAATTGCCCCCTTGATGGTTGCATACATGCTAGAAAGAGAGTTGGTCCGCAAAACGAGGTTCCTCCCAGTGGCTGGTGGGACAAGCAGTGTCTACATTGAGGTGCTGCATTTAACCCAGGGGACATGCTGGGAGCAGATGTACACTCCAGGAGGGGAAGTGAGAAATGATGATGTTGACCAAAGCTTAATTATAGCTGCCAGAAACATAGTAAGAAGAGCAACTGTATCAGCAGACCCACTAGCATCTCTATTGGAGATGTGCCACAGCACACAGATTGGGGGAATAAGGATGGTAGACATTCTTCGGCAAAATCCAACAGAGGAACAAGCTGTGGACATATGCAAGGCAGCAATGGGCTTAAGGATTAGCTCGTCTTTCAGCTTTGGTGGATTCACTTTCAAAAGAACAAGCGGGTCGTCAGCTAAAAGAGAAGAAGAAGTGCTTACGGGCAACCTTCAAACATTGAAAATAAGAGTACATGAGGGGTATGAAGAGTTCACAATGGTTGGGAGAAGAGCAACAGCTATTCTCAGAAAAGCAACCAGAAGATTGATCCAGCTAATAGTAAGTGGGAGAGACGAGCAGTCAATTGCTGAAGCAATAATTGTGGCCATGGTATTCTCACAAGAAGATTGCATGATCAAAGCAGTTCGAGGTGATCTGAACTTTGTCAATAGGGCAAACCAGCGGCTGAACCCCATGCATCAACTCCTGAGACACTTCCAAAAGGATGCAAAAGTTCTTTTCCATAACTGGGGAATTGAACCCATTGACAATGTAATGGGAATGATCGGAATACTGCCCGATATGACTCCAAGTACTGAGATGTCGCTGAGGGGAATACGAGTCAGTAAGATGGGAGTGGATGAATATTCCAGCACAGAGAGGGTGGTAGTGAGCATTGACCGATTTTTAAGAGTTCGGGACCAACGGGGGAACGTACTATTGTCACCTGAAGAAGTCAGCGAGACACAAGGAACAGAGAAGCTGACAATAACTTATTCGTCATCAATGATGTGGGAGATCAATGGTCCTGAATCGGTGTTGGTCAATACTTATCAGTGGATCATCAGAAACTGGGAAACTGTGAAAATTCAATGGTCACAGGATCCCACAATGTTATATAATAAGATGGAATTCGAGCCATTTCAGTCTCTGGTCCCTAAGGCAGCCAGAGGTCAGTACAGTGGATTCGTGAGGACACTATTCCAACAAATGCGGGACGTGCTTGGAACTTTTGACACTGTTCAGATAATAAAACTCCTCCCATTTGCTGCTGCTCCACCAGAACAAAGTAGGATGCAGTTCTCCTCCCTAACTGTGAATGTGAGAGGATCAGGAATGAGGATACTGGTAAGAGGCAATTCTCCAGTGTTCAATTACAACAAGGCCACCAAAAGGCTCACAGTTCTCGGAAAGGATGCAGGTGCATTGACCGAAGATCCAGATGAAGGCACAGCTGGAGTAGAATCTGCTGTTCTAAGAGGATTCCTCATTTTGGGCAAAGAAGACAAGAGATATGGCCCAGCATTGAGCATCAATGAGCTGAGCAATCTTGCAAAAGGAGAGAAGGCTAATGTGCTAATTGGGCAAGGAGACGTGGTGTTGGTAATGAAACGGAAACGGGACTCTAGCATACTTACTGACAGCCAGACAGCGACCAAAAGAATTCGGATGGCCATCAATTAG
>A/duck/Altai/1285/1991/08/15(H5N3)  segment 1
ATGGAGAGAATAAAAGAACTAAGAGATTTGATGTCGCAGTCTCGCACTCGCGAGATACTGACAAAAACCACTGTGGACCATATGGCTATAATCAAGAAATACACATCAGGAAGACAGGAGAAGAATCCTGCACTCAGAATGAAATGGATGATGGCAATGAAATATCCGATTACAGCTGACAAAAGGATAATGGAAATGATCCCTGAAAGGAATGAGCAAGGCCAAACTCTCTGGAGCAAGACAAATGATGCTGGGTCAGACAGAGTGATGGTGTCGCCTCTGGCTGTGACGTGGTGGAACAGGAATGGACCAACGACAAGTACAGTCCATTATCCAAAGGTATATAAAACCTATTTTGAAAAGGTTGAAAGATTGAAACATGGAACCTTTGGCCCTGTCCACTTCCGGAATCAAGTTAAAATACGCCGCAGGGTTGACATAAACCCAGGCCATGCAGATCTCAGTGCTAAAGAAGCACAAGATGTCATTATGGAGGTCGTTTTCCCAAATGAAGTTGGGGCCAGGATACTGACATCAGAGTCTCAGTTGACAATAACAAAAGAAAAGAAGGAGGAACTTCAGGACTGTAAGATTGCTCCTTTAATGGTGGCATACATGCTAGAGAGAGAGCTGGTTCGCAAGACCAGATTCCTACCAGTAGCTGGCGGAACAAGCAGCGTGTATATTGAAGTATTGCATTTGACTCAAGGGACCTGCTGGGAACAGATGTACACTCCAGGAGGGGAGGTGAGAAATGATGATGTTGATCAGAGTTTAATCATTGCTGCTAGGAACATTGTTAGGAGAGCAACAGTATCAGCAGACCCATTGGCTTCGCTCTTGGAGATGTGCCATAGTACACAAATTGGCGGGATAAGAATGGTGGACATCCTTAGACAAAACCCAACAGAAGAGCAAGCTGTGGATATATGCAAGGCGGCAATGGGTCTAAGAATCAGTTCATCCTTCAGCTTTGGAGGTTTCACTTTCAAACGAACAAGTGGGTCATCTGTCAAAAGGGAGGAGGAAGTGCTTACAGGCAACCTTCAGACATTGAAAATAAGGGTACATGAAGGGTATGAGGAGTTCACAATGGTTGGGCGAAGAGCAACAGCCATTCTAAGGAAAGCAACCAGAAGGCTGATCCAACTGATAGTGAGTGGGAGAGATGAACAATCAATCGCTGAAGCGATCATCGTAGCAATGGTGTTTTCACAAGAGGATTGCATGATAAAGGCAGTCCGAGGTGATTTGAATTTCGTGAACAGAGCGAACCAACGGCTGAATCCCATGCACCAACTCCTGAGGCACTTCCAAAAGGATGCAAAGGTGTTGTTTCAGAACTGGGGAATTGAACCCATCGATAATGTCATGGGGATGATTGGAATATTGCCTGACATGACTCCCAGCACGGAAATGTCACTAAGGGGAGTGAGAGTGAGTAAAATGGGAGTGGATGAATATTCCAGTACTGAGAGAGTGGTCGTGAGCATTGATCGTTTCTTGAGGGTCCGAGATCAGCGGGGGAACGTGCTCTTATCCCCTGAAGAGGTCAGTGAAACGCAGGGAACGGAAAAGTTGACGATAACATATTCATCATCCATGATGTGGGAAATTAACGGTCCAGAGTCGGTGTTAGTTAATACATATCAATGGATCATTAGGAATTGGGAGACTGTGAAGATTCAGTGGTCCCAAGACCCTACAATGCTATACAATAAGATGGAGTTTGAACCCTTTCAATCTTTGGTGCCTAAGGCTGCCAGAGGCCAATATAGTGGATTTGTGAGAACACTATTCCAGCAGATGCGTGATGTGTTGGGGACATTTGATACTGTTCAAATAATAAAGCTACTACCATTTGCAGCAGCCCCACCGGAGCAGAGTAGGATGCAATTTTCTTCTCTAACTGTGAATGTGAGGGGCTCTGGAATGAGAATACTTGTGAGGGGTAATTCCCCTGTGTTTAACTACAACAAGGCAACCAAGAGGCTTACAGTCCTCGGAAAGGATGCAGGTGCACTTACAGAAGACCCAGATGAGGGAGCAGCAGGAGTGGAGTCTGCGGTATTGAGAGGGTTTCTAATTTTAGGCAAAGAAGACAAAAGATATGGACCAGCATTGAGCATCAACGAATTGAGCAATCTTGCAAAGGGGGAGAAGGCTAATGTGTTGATAGGGCAAGGAGACGTAGTGTTGGTAATGAAACGGAAACGGGACTCTAGCATACTTACTGACAGCCAGACAGCGACCAAAAGAATTCGGATGGCCATCAATTAG



Code:
>A/pintail/Alaska/779/2005/08/20(H3N8)  PB2
MERIKELRDLMSQSRTREILTKTTVDHMAIIKKYTSGRQEKNPALRMKWMMAMKYPITADKRIMEMIPERNEQGQTLWSKTNDAGSDRVMVSPLAVTWWNRNGPTTSTVHYPKVYKTYFEKVERLKHGTFGPVHFRNQVKIRRRVDINPGHADLSAKEAQDVIMEVVFPNEVGARILTSESQLTITKEKKEELQDCKIAPLMVAYMLERELVRKTRFLPVAGGTSSVYIEVLHLTQGTCWEQMYTPGGEVRNDDVDQSLIIAARNIVRRATVSADPLASLLEMCHSTQIGGIRMVDILRQNPTEEQAVDICKAAMGLRISSSFSFGGFTFKRTSGSSAKREEEVLTGNLQTLKIRVHEGYEEFTMVGRRATAILRKATRRLIQLIVSGRDEQSIAEAIIVAMVFSQEDCMIKAVRGDLNFVNRANQRLNPMHQLLRHFQKDAKVLFHNWGIEPIDNVMGMIGILPDMTPSTEMSLRGIRVSKMGVDEYSSTERVVVSIDRFLRVRDQRGNVLLSPEEVSETQGTEKLTITYSSSMMWEINGPESVLVNTYQWIIRNWETVKIQWSQDPTMLYNKMEFEPFQSLVPKAARGQYSGFVRTLFQQMRDVLGTFDTVQIIKLLPFAAAPPEQSRMQFSSLTVNVRGSGMRILVRGNSPVFNYNKATKRLTVLGKDAGALTEDPDEGTAGVESAVLRGFLILGKEDKRYGPALSINELSNLAKGEKANVLIGQGDVVLVMKRKRDSSILTDSQTATKRIRMAIN}
>A/duck/Altai/1285/1991/08/15(H5N3)   PB2
MERIKELRDLMSQSRTREILTKTTVDHMAIIKKYTSGRQEKNPALRMKWMMAMKYPITADKRIMEMIPERNEQGQTLWSKTNDAGSDRVMVSPLAVTWWNRNGPTTSTVHYPKVYKTYFEKVERLKHGTFGPVHFRNQVKIRRRVDINPGHADLSAKEAQDVIMEVVFPNEVGARILTSESQLTITKEKKEELQDCKIAPLMVAYMLERELVRKTRFLPVAGGTSSVYIEVLHLTQGTCWEQMYTPGGEVRNDDVDQSLIIAARNIVRRATVSADPLASLLEMCHSTQIGGIRMVDILRQNPTEEQAVDICKAAMGLRISSSFSFGGFTFKRTSGSSVKREEEVLTGNLQTLKIRVHEGYEEFTMVGRRATAILRKATRRLIQLIVSGRDEQSIAEAIIVAMVFSQEDCMIKAVRGDLNFVNRANQRLNPMHQLLRHFQKDAKVLFQNWGIEPIDNVMGMIGILPDMTPSTEMSLRGVRVSKMGVDEYSSTERVVVSIDRFLRVRDQRGNVLLSPEEVSETQGTEKLTITYSSSMMWEINGPESVLVNTYQWIIRNWETVKIQWSQDPTMLYNKMEFEPFQSLVPKAARGQYSGFVRTLFQQMRDVLGTFDTVQIIKLLPFAAAPPEQSRMQFSSLTVNVRGSGMRILVRGNSPVFNYNKATKRLTVLGKDAGALTEDPDEGAAGVESAVLRGFLILGKEDKRYGPALSINELSNLAKGEKANVLIGQGDVVLVMKRKRDSSILTDSQTATKRIRMAIN}


_________________
no patents on genes, publish the GISAID sequences !


Top
 Profile  
 
Display posts from previous:  Sort by  
Post new topic Reply to topic  [ 286 posts ]  Go to page Previous  1, 2, 3, 4, 5, 6, 7 ... 29  Next

All times are UTC - 5 hours [ DST ]


Who is online

Users browsing this forum: No registered users and 1 guest


You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot post attachments in this forum

Search for:
Jump to:  
Powered by phpBB® Forum Software © phpBB Group