Rhiza Labs FluTracker Forum

niman posted a video......... ?

Cool Song! Great analogy!

_________________
"Old Mother Goose, when she wanted to wander, would ride through the air on a very fine gander."
1916
"Mother Goose had a house,
'Twas built in a wood,
Where an owl at the door
For sentinel stood."

Norway reported finding a mutated virus in three people who died or were severely ill. The mutation, known as D222G on the receptor binding domain, allow the virus to grow deeper in the lungs.

The mutation does not appear to be circulating and may have spontaneously arisen in the three patients, said Geir Stene-Larsen, director of the Norwegian Institute of Public Health. Only 3 of Norway’s 70 tested samples had it.

Asked about that, Dr. Schuchat said the same mutation had also been found in mild cases in several countries, and it did not make the virus resistant to vaccine or to treatment with drugs like Tamiflu. She said she did not want to “underplay” it, adding that “it’s too soon to say what this will mean long term.”

The D222G mutation allows the virus to bind to receptors on cells lining the lungs, which are slightly different from those in the nose and throat. Henry L. Niman, a flu tracker in Pittsburgh, has been warning for a week that D225G — the same mutation under a different numbering system — has been repeatedly found in Ukraine, which is in the grips of a severe outbreak and where surprising numbers of people have died with lung hemorrhages — the kind of pneumonia that can be caused by an immune system’s “cytokine storm” attacking a new virus.

http://www.nytimes.com/2009/11/21/health/21flu.html

_________________
www.twitter.com/hniman

225E or 225G?

Dr. Niman, I'm pretty ignorant about virology in general, but I'm curious: can 225E and 225G be found in the same sequence? And what are the arguments for 225E vs. 225G resulting in a deadlier virus? Do they have the same effect on viral behavior or is this just a guess anyway? I came across this article and I was hoping you could clarify: http://pf11.blogspot.com/2009/11/225g-p ... ation.html.

D225G, D225N, and D225E have all been identified in swine H1N1. Mixtures are posiible, but most mixtures are one of teh three listed above with wild type (D at position 225). I predicted D225G on teh basis of level of movement from one background to another and association with D225G with lung tissues in Sao Paulo as well as presence in tissues from 1918 and 1919.

_________________
www.twitter.com/hniman

http://www.ncbi.nlm.nih.gov/pubmed/1634 ... nalpos=112

Mol Biol. 2006 Feb 3;355(5):1143-55. Epub 2005 Nov 18.

Glycan microarray analysis of the hemagglutinins from modern and pandemic influenza viruses reveals different receptor specificities.
Stevens J, Blixt O, Glaser L, Taubenberger JK, Palese P, Paulson JC, Wilson IA.

Department of Molecular Biology, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037, USA.

Influenza A virus specificity for the host is mediated by the viral surface glycoprotein hemagglutinin (HA), which binds to receptors containing glycans with terminal sialic acids. Avian viruses preferentially bind to alpha2-3-linked sialic acids on receptors of intestinal epithelial cells, whereas human viruses are specific for the alpha2-6 linkage on epithelial cells of the lungs and upper respiratory tract. To define the receptor preferences of a number of human and avian H1 and H3 viruses, including the 1918 H1N1 pandemic strains, their hemagglutinins were analyzed using a recently described glycan array. The array, which contains 200 carbohydrates and glycoproteins, not only revealed clear differentiation of receptor preferences for alpha2-3 and/or alpha2-6 sialic acid linkage, but could also detect fine differences in HA specificity, such as preferences for fucosylation, sulfation and sialylation at positions 2 (Gal) and 3 (GlcNAc, GalNAc) of the terminal trisaccharide. For the two 1918 HA variants, the South Carolina (SC) HA (with Asp190, Asp225) bound exclusively alpha2-6 receptors, while the New York (NY) variant, which differed only by one residue (Gly225), had mixed alpha2-6/alpha2-3 specificity, especially for sulfated oligosaccharides. Only one mutation of the NY variant (Asp190Glu) was sufficient to revert the HA receptor preference to that of classical avian strains. Thus, the species barrier, as defined by the receptor specificity preferences of 1918 human viruses compared to likely avian virus progenitors, can be circumvented by changes at only two positions in the HA receptor binding site. The glycan array thus provides highly detailed profiles of influenza receptor specificity that can be used to map the evolution of new human pathogenic strains, such as the H5N1 avian influenza.

_________________
www.twitter.com/hniman

so WHO+Sweden think G225 happens in each host separately while niman
thinks it happened by initial infection with both viruses, right ?

Can't it be tested ?
Infect ferrets with pure D225,pure G225 or such

didn't they test it long ago when they examined the 1918/9 samples ?

was G225 responsible for the cytokene storm in 1918 ?

_________________
no patents on genes, publish the GISAID sequences !

60. J Gen Virol.. [Epub ahead of print]

Alterations in receptor binding properties of swine influenza viruses of H1
subtype after isolation in embryonated chicken eggs.

Takemae N, Ruttanapumma R, Parchariyanon S, Yoneyama S, Hayashi T, Hiramatsu H,
Sriwilaijaroen N, Uchida Y, Kondo S, Yagi H, Kato K, Suzuki Y, Saito T.

Thailand-Japan Zoonotic Diseases Collaboration Center; National Institute of
Animal Health,Japan;

Alterations of the receptor binding properties of swine influenza A viruses
(SIVs) during their isolation in embryonated chicken eggs have not been well
studied. In this study, the receptor binding properties of classical H1 SIVs
isolated solely in eggs or Madin-Darby canine kidney (MDCK) cells were examined.
Sequencing analysis revealed substitutions of D190V/N or D225G in the HA
molecules in egg-isolates, while MDCK-isolates retained identical HA genes with
the original viruses presented in the clinical samples. Egg-isolates with
substitution of either D190V/N or D225G had increased hemagglutinating activity
for mouse and sheep erythrocytes but decreased activity for rabbit erythrocytes.
Additionally, egg-isolates with D225G increased the hemagglutination activity of
chicken erythrocytes. Direct binding assay using sialylglycopolymer, which
possesses either a 5-N-acetylneuraminic acid (Neu5Ac) alpha2,6galactose (Gal) or
a Neu5Acalpha2,3Gal linkage revealed that the egg-isolates used in this study
showed higher binding activity to the Neu5Acalpha2,3Gal receptor than
MDCK-isolates. Increased activity of the egg-isolates to the Neu5Acalpha2,3Gal
receptor was also confirmed by hemagglutination assay with re-sialylated chicken
erythrocytes by Galbeta1,3/4GlcNAcalpha2,3-sialyltransferase. These observations
were reinforced by flow-cytometric and N-glycan analyses of the erythrocytes. The
alpha2,3-linked sialic acids were dominantly expressed on the surfaces of mouse
and sheep erythrocytes. Chicken erythrocytes expressed Neu5Acalpha2,3Gal more
abundantly than Neu5Acalpha2,6Gal, and rabbit erythrocytes expressed both
5-N-glycolylneuraminic acid (Neu5Gc) alpha2,6Gal and Neu5Acalpha2,6Gal. Our
results clearly demonstrated that classical H1 SIVs underwent alterations in
receptor binding activity associated with an amino acid substitution in the HA
protein during isolation and propagation in chicken embryonated eggs.

PMID: 20007353 [PubMed - as supplied by publisher]

_________________
no patents on genes, publish the GISAID sequences !

Ukraine sequences by Mill Hill and CDC came directly from clinical samples and did not involve cloning in eggs or MDCK cells.

_________________
www.twitter.com/hniman

What is the next prediction?

the full genome from Norway/2924 was uploaded

24 mutations:


A1020T(1),C2137T(1)
G1089A(2),
G1923A(3),
A716R(4),A1281G(4),A1434G(4),
T1221C(6),
G333A(7),G414A(7),G555A(7),T763C(7),
A367G(8),

plus the 11 Cancun-markers

A1281G(4) was also found in some of the secret Ukraine-sequences
with D225G=A716G(4) , as had been leaked through.

several of the markers are also in Omsk/2


---------edit----------------

norway + omsk :

                                     000000111122222 00000001111 0000011111 00000000000000000000000000000000000001111111111111 00000111 000001 00000000000 000 
                                     004579004701112 11134670026 0005700499 00111222233333444455556667777788888990011112234455 01299012 337782 11344456678 238 
                                     362416121233697 55606385819 3569767429 02478345901136235611775561115912337331123578980317 43966844 184672 77312950369 562 
                                     666670302107374 69205968986 0167787435 42596432785880379069037856799279370042852911338422 72869638 602231 34345250032 272 
-codon-position----------------------      2 2221 1         2  1        1   1112     2  2  2 1     122 2  112   111 111   1    2 1      121    2   2    11  1  
---Index-----------------------------GGGGCCTACAACGTC GAGAATTAGGA TGAGAGCCGG ACCAACTTAAAGTGCATCATCCGTGATAGTGACACGAGTGTAGATCCAAA GCGATGGG GTAGGT GAGGCGGGGTG AAC 
   1 >A/******/index/2009/02/01      ............... ........... .......... .................................................. ........ ...... ........... ... 
   2 >A/Norway/3433/2009/2009/09     --------------- ----------- ---------- .........G.........C...A.....C..............CTT..G -------- ------ ----------- --- 
   3 >A/Omsk/01/2009/2009/           --------------- ----------- ---------- .......................A...G..................T... ..A...AA AC...C ..A.T...... GG. 
   4 >A/Norway/3569/2009/2009/09     --------------- ----------- ---------- ...........AC.T........A......................T... -------- ------ ----------- --- 
   5 >A/Norway/3689/2009/2009/10     --------------- ----------- ---------- .....T.................A..........T......C....T... -------- ------ ----------- --- 
   6 >A/Norway/2917/2009/2009/08     --------------- ----------- ---------- G..................................T..........T... -------- ------ ----------- --- 
   7 >A/Norway/1359/2009/2009/05     --------------- ----------- ---------- ....G............................................. -------- ------ ----------- --- 
   8 >A/Norway/1177/2009/2009/05     C..A..C...G...T AGAG...G... CAG....... .TA............................................... .T...... ...... ..........A ..G 
   9 >A/Norway/1168/2009/2009/05     ...A..C...G.... AGAG...G... .A........ ..A............................................... .T...... ...... ..........A ... 
  10 >A/Tomsk/01/2009/2009/          ...A....T....C. ...GG..G..G .......... .......................A.......G..............T... ..A...AA ....A. .....A.A... ... 
  11 >A/Tomsk/02/2009/2009/          ...A....T....C. ........... .........A .......C..........G....A......................T... ..A...AA .....C CG...A.A... .G. 
  12 >A/Norway/1573/2009/2009/05     --------------- ----------- ---------- ..................G...AA................G.....T... -------- ------ ----------- --- 
  13 >A/Norway/1623/2009/2009/05     --------------- ----------- ---------- ..................G...AA......................T... -------- A.G... .....A.A... --- 
  14 >A/Norway/1613/2009/2009/05     --------------- ----------- ---------- ....................T..A......................T... -------- A.G... .....A.A... --- 
  15 >A/Norway/2010/2009/2009/06     --------------- ----------- ---------- .............A.........A......................T... -------- A.GA.. .....A.A... --- 
  16 >A/Norway/3214/2009/2009/08     --------------- ----------- ---------- ................C......A.........G............T... -------- ------ ----------- --- 
  17 >A/Norway/3036/2009/2009/08     --------------- ----------- ---------- ......C................A......................T... -------- ------ ----------- --- 
  18 >A/Norway/3779/2009/2009/10     --------------- ----------- ---------- .......................A............G.C.......T... -------- ------ ----------- --- 
  19 >A/Norway/3797/2009/2009/10     --------------- ----------- ---------- .......................A..................A...T... -------- ------ ----------- --- 
  20 >A/Norway/3273/2009/2009/08     --------------- ----------- ---------- .......................A......................T.G. -------- ------ ----------- --- 
  21 >A/Norway/4020/2009/2009/10     --------------- ----------- ---------- .......................A...................G..T... -------- ------ ----------- --- 
  22 >A/Norway/3278/2009/2009/08     --------------- ----------- ---------- .......................A....A..............G..T... -------- ------ ----------- --- 
  23 >A/Omsk/02/2009/2009/           .......T...TA.. ........... ....G..... .......................A...................G..T... ..ACA.AA A.G..C .....AAA... GG. 
  24 >A/Norway/3855/2009/2009/10     --------------- ----------- ---------- .......................A...................G..T... -------- ------ ----------- --- 
  25 >A/Norway/3370/2009/2009/09     --------------- ----------- ---------- ...G....G..............A.............A.....G..T... -------- ------ ----------- --- 
  26 >A/Norway/3371/2009/2009/08     --------------- ----------- ---------- .......................A.............A.....G..T... -------- ------ ----------- --- 
  27 >A/Norway/4021/2009/2009/10     --------------- ----------- ---------- .....................A.A.............A.....G..T... -------- ------ ----------- --- 
  28 >A/Norway/3440/2009/2009/09     --------------- ----------- ---------- .....................A.AC.....A......A.....G..T... -------- ------ ----------- --- 
  29 >A/Norway/3364-2/2009/2009/09   .AA....T...TA.. .....C...A. ...A.AT... .....................A.A......A......A.....G..T... ..A..AAA A.G..C ..AA.AAA... GG. 
  30 >A/Norway/2924/2009/2009/08     .......T...TA.. ........A.. ........A. .......................A.R.................G..TG.. ..A...AA A.G..C ..AA.AAA.C. GG. 
  31 >A/Norway/3206-3/2009/2009/09   ....TT...G..A.. ......A.... .......T.. .................T.....A.GA...................T... A.A...AA A.G.A. .....A.AA.. .G. 
  32 >A/Norway/3059/2009/2009/08     --------------- ----------- ---------- ...............G.......A..A...................T... -------- ------ ----------- --- 
  33 >A/Norway/2674/2009/2009/07     --------------- ----------- ---------- .......................A..A...................T... -------- ------ ----------- --- 
  34 >A/Norway/4023/2009/2009/10     --------------- ----------- ---------- ..........T............A..A...................T... -------- ------ ----------- --- 
  35 >A/Norway/2690/2009/2009/07     --------------- ----------- ---------- .......................A..A...................T... -------- ------ ----------- --- 
  36 >A/Norway/3478/2009/2009/09     --------------- ----------- ---------- .......................A..A...A.T......A......T... -------- ------ ----------- --- 
  37 >A/Cancun-NY/Index/2009/04/15   ............A.. ........... .......... .......................A......................T... ..A...AA A.G... .....A.A... .G. 

apparantly Omsk/2 was earlier and has 5 out of 9 non-Cancun-markers in common
with Norway/2924, so that's a clear relationship

A1020T(1),C2137T(1)
A777G(3)
A1281G(4)
A966C(5),T969A(5)
T1221C(6)
G555A(7)
A252G(8)

_________________
no patents on genes, publish the GISAID sequences !