Oregon cat dies from swine flu, officials say

D Covey · **Joined:** Fri Aug 21, 2009 3:14 pm **Posts:** 7

http://www.registerguard.com/csp/cms/si ... /story.csp
"Lebanon cat has died from the H1N1 virus, state veterinary officials said Wednesday.
It is believed to be the first feline H1N1 fatality in the country, said Raina Dey of the Oregon Veterinary Medical Association and Emilio DeBess, state public health veterinarian.
The veterinary officials said they believe the cat caught the virus from a human. DeBess said it may also be possible for cats to transmit the virus to humans.
The cat, a 10-year-old male, was brought to the Animal Clinic in Lebanon on Nov. 4 with labored breathing. A family member had been sick with a flulike illness about a week earlier.
The cat’s condition worsened and, three days later, it died. The Oregon State University Veterinary Diagnostic Laboratory has since confirmed that the cat was positive for H1N1, also referred to as the swine flu."

rob · **Joined:** Tue Aug 11, 2009 8:37 pm **Posts:** 1849

Quote:

It is believed to be the first feline H1N1 fatality in the country, said Raina Dey of the Oregon Veterinary Medical Association and Emilio DeBess, state public health veterinarian.

How many people have their pets tested for swine flu when they die? Costs money. Public health agencies are not doing it for free. I suspect many mammal victims of swine flu have been buried in back yards untested.

VJP · **Joined:** Wed Aug 19, 2009 10:38 am **Posts:** 968

rob wrote:

How many people have their pets tested for swine flu when they die? Costs money. Public health agencies are not doing it for free. I suspect many mammal victims of swine flu have been buried in back yards untested.

Good point.
My vet was just here yesterday, which has become outrageously expensive as it is. And, as much as I love my pets, if one seemed to die of a virus, that would be all the info I'd need to know.

niman · **Posted:** Wed Jan 20, 2010 8:04 am

Cat had RBD change Q226R

http://www.ncbi.nlm.nih.gov/nuccore/GU471688

niman · **Posted:** Wed Jan 20, 2010 8:05 am

LOCUS GU471688 1701 bp cRNA linear VRL 19-JAN-2010
DEFINITION Influenza A virus (A/cat/OR/29573/2009(H1N1)) segment 4
hemagglutinin (HA) gene, complete cds.
ACCESSION GU471688
VERSION GU471688.1 GI:284027643
DBLINK Project:37813
KEYWORDS .
SOURCE Influenza A virus (A/cat/OR/29573/2009(H1N1))
ORGANISM Influenza A virus (A/cat/OR/29573/2009(H1N1))
Viruses; ssRNA negative-strand viruses; Orthomyxoviridae;
Influenzavirus A.
REFERENCE 1 (bases 1 to 1701)
AUTHORS Lohr,C.V., DeBess,E., Baker,R.J., Jenkins-Moore,M., Koster,L.G.,
Trujillo,J.D., Yoon,K.J. and Strait,E.
TITLE Mortality in domestic cats after natural infection with influenza A
pandemic (H1N1) 2009 virus by humans
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 1701)
AUTHORS Koster,L.G. and Killian,M.L.
TITLE Direct Submission
JOURNAL Submitted (15-JAN-2010) Diagnostic Virology Laboratory, National
Veterinary Services Laboratories, 1920 Dayton Road, Ames, IA 50010,
USA
FEATURES Location/Qualifiers
source 1..1701
/organism="Influenza A virus (A/cat/OR/29573/2009(H1N1))"
/mol_type="viral cRNA"
/strain="A/cat/OR/29573/2009"
/serotype="H1N1"
/host="cat"
/db_xref="taxon:709905"
/segment="4"
/country="USA:Oregon"
/collection_date="09-Nov-2009"
/note="lineage: swl"
gene 1..1701
/gene="HA"
CDS 1..1701
/gene="HA"
/codon_start=1
/product="hemagglutinin"
/protein_id="ADB66689.1"
/db_xref="GI:284027644"
/translation="MKAILVVLLYTFATANADTLCIGYHANNSTDTVDTVLEKNVTVT
HSVNLLEDKHNGKLCKLRGVAPLHLGKCNIAGWILGNPECESLSTASSWSYIVETSSS
DNGTCYPGDFIDYEELREQLSSVSSFERFEIFPKTSSWPNHDSNKGVTAACPHAGAKS
FYKNLIWLVKKGNSYPKLSKSYINDKGKEVLVLWGIHHPSTSADQQSLYQNADAYVFV
GTSRYSKKFKPEIAIRPKVRDREGRMNYYWTLVEPGDKITFEATGNLVVPRYAFAMER
NAGSGIIISDTPVHDCNTTCQTPKGAINTSLPFQNIHPITIGKCPKYVKSTKLRLATG
LRNVPSIQSRGLFGAIAGFIEGGWTGMVDGWYGYHHQNEQGSGYAADLKSTQNAIDKI
TNKVNSVIEKMNTQFTAVGKEFNHLEKRIENLNKKVDDGFLDIWTYNAELLVLLENER
TLDYHDSNVKNLYEKVRSQLKNNAKEIGNGCFEFYHKCDNTCMESVKNGTYDYPKYSE
EAKLNREEIDGVKLESTRIYQILAIYSTVASSLVLVVSLGAISFWMCSNGSLQCRICI"
ORIGIN
1 atgaaggcaa tactagtagt tctgctatat acatttgcaa ccgcaaatgc agacacatta
61 tgtataggtt atcatgcgaa caattcaaca gacactgtag acacagtact agaaaagaat
121 gtaacagtaa cacactctgt taaccttcta gaagacaagc ataacgggaa actatgcaaa
181 ctaagagggg tagccccatt gcatttgggt aaatgtaaca ttgctggctg gatcctggga
241 aatccagagt gtgaatcact ctccacagca agctcatggt cctacattgt ggaaacatct
301 agttcagaca atggaacgtg ttacccagga gatttcatcg attatgagga gctaagagag
361 caattgagct cagtgtcatc atttgaaagg tttgagatat tccccaagac aagttcatgg
421 cccaatcatg actcgaacaa aggtgtaacg gcagcatgtc ctcatgctgg agcaaaaagc
481 ttctacaaaa atttaatatg gctagttaaa aaaggaaatt catacccaaa gctcagcaaa
541 tcctacatta atgataaagg gaaagaagtc ctcgtgctat ggggcattca ccatccatct
601 actagtgctg accaacaaag tctctatcag aatgcagatg catatgtttt tgtggggaca
661 tcaagataca gcaagaagtt caagccggaa atagcaataa gacccaaagt gagggatcga
721 gaagggagaa tgaactatta ctggacacta gtagagccgg gagacaaaat aacattcgaa
781 gcaactggaa atctagtggt accgagatac gcattcgcaa tggaaagaaa tgctggatct
841 ggtattatca tttcagatac accagtccac gattgcaata caacttgtca aacacccaag
901 ggtgctataa acaccagcct cccatttcag aatatacatc cgatcacaat tggaaaatgt
961 ccaaaatatg taaaaagcac aaaattgaga ctggccacag gattgaggaa tgtcccgtct
1021 attcaatcta gaggcctatt tggggccatt gccggcttca ttgaaggggg gtggacaggg
1081 atggtagatg gatggtacgg atatcaccat caaaatgagc aggggtcagg atatgcagcc
1141 gacctgaaga gcacacagaa tgccattgac aagattacta acaaagtaaa ttctgttatt
1201 gaaaagatga atacacagtt cacagcagta ggtaaagagt tcaaccacct ggaaaaaaga
1261 atagagaatt taaataaaaa agttgatgat ggtttcctgg acatttggac ttacaatgcc
1321 gaactgttgg ttctattgga aaatgaaaga actttggact accacgattc aaatgtgaag
1381 aacttatatg aaaaggtaag aagccagtta aaaaacaatg ccaaggaaat tggaaacggc
1441 tgctttgaat tttaccacaa atgcgataac acgtgcatgg aaagtgtcaa aaatgggact
1501 tatgactacc caaaatactc agaggaagca aaattaaaca gagaagaaat agatggggta
1561 aagctggaat caacaaggat ttaccagatt ttggcgatct attcaactgt cgccagttca
1621 ttggtactgg tagtctccct gggggcaatc agtttctgga tgtgctctaa tgggtctcta
1681 cagtgtagaa tatgtattta a

niman · **Posted:** Wed Jan 20, 2010 8:13 am

In the first case, a cat died Nov. 7 in Lebanon.It got sick about a week after a child in the household came down with swine flu. The second cat, which caught the H1N1 virus from its owner on the coast, died Nov. 24.

That cat, an 8-year-old spayed female, had a history of allergies and chronic sinusitis, possibly making it more susceptible to the virus

http://www.oregonlive.com/health/index. ... ter_c.html.

niman · **Posted:** Wed Jan 20, 2010 8:37 am

Q226R travel log

gb|GU471688.1| Influenza A virus (A/cat/OR/29573/2009(H1N1)) ... 34.2 3.0
gb|GU367325.1| Influenza A virus (A/Novgorod/01/2009(H1N1)) s... 34.2 3.0
gb|GQ915076.1| Influenza A virus (A/Singapore/TLL10/2009(H1N1... 34.2 3.0
gb|GQ906804.1| Influenza A virus (A/reassortant/NYMC X-181A(C... 34.2 3.0
gb|GQ906801.1| Influenza A virus (A/reassortant/NYMC X-181(Ca... 34.2 3.0
gb|GQ527165.1| Influenza A virus (A/Singapore/TLL51/2009(H1N1... 34.2 3.0
gb|GQ527167.1| Influenza A virus (A/Omsk/01/2009(H1N1)) segme... 34.2 3.0
gb|GQ505853.1| Influenza A virus (A/Irkutsk/02/2009(H1N1)) se... 34.2 3.0
gb|GQ496602.1| Influenza A virus (A/Lishui/01/2009(H1N1)) seg... 34.2 3.0
gb|GQ485656.1| Influenza A virus (A/Ekaterinburg/01/2009(H1N1... 34.2 3.0
gb|GQ374895.1| Influenza A virus (A/reassortant/IDCDC-RG20(Te... 34.2 3.0
gb|GQ359758.1| Influenza A virus (A/Zhejiang/DTID-ZJU01/2009(... 34.2 3.0
gb|GQ303340.1| Influenza A virus (A/Mexico/InDRE4487/2009(H1N... 34.2 3.0
gb|GQ247722.1| Influenza A virus (A/resassortant/IVR-153(A/Ca... 34.2 3.0
gb|GQ232019.1| Influenza A virus (A/Texas/17/2009(H1N1)) segm... 34.2 3.0
gb|GQ219781.1| Influenza A virus (A/reassortant/IDCDC-RG15(Te... 34.2 3.0
gb|GQ214335.1| Influenza A virus (A/reassortant/NYMC X-179A(C... 34.2 3.0
gb|GQ183633.1| Influenza A virus (A/Finland/553/2009(H1N1)) s... 34.2 3.0
gb|GQ149641.1| Influenza A virus (A/Mexico/4603/2009(H1N1)) s... 34.2 3.0

niman · **Posted:** Wed Jan 20, 2010 8:57 am

Commentary

http://www.recombinomics.com/News/01201 ... at_OR.html

neuromedia · **Joined:** Wed Aug 26, 2009 4:15 pm **Posts:** 580

niman wrote:

Cat had RBD change Q226R

http://www.ncbi.nlm.nih.gov/nuccore/GU471688

Earlier isolate (A/cat/IA/26991/2009(H1N1)) did not present such RDB changes:
Topic -Pet Sequences at Genbank
viewtopic.php?f=26&t=3975

I don’t know much about the Oregon cat, but the virus travelog signals a rather nasty “pedigree”:

(A/cat/OR/29573/2009(H1N1))
Q226R (Arginine) CgA

Code:

(A/California/08/2009(H1N1))
CDS:hemagglutinin [I  221    S  R  Y  S  K  K  F  K  P  E  I  A  I  R  P  K  V  R  D  Q 
Query                 661   TCAAGATACAGCAAGAAGTTCAAGCCGGAAATAGCAATAAGACCCAAAGTGAGGGATCAA  720
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct                 661   TCAAGATACAGCAAGAAGTTCAAGCCGGAAATAGCAATAAGACCCAAAGTGAGGGATCGA  720
CDS:hemagglutinin [I  221    S  R  Y  S  K  K  F  K  P  E  I  A  I  R  P  K  V  R  D  R 
(A/cat/OR/29573/2009(H1N1))

First travelog isolate:
A/Novgorod/01/2009
D225E (Glutamic acid) GAa
Q226R (Arginine) CgA

Code:

 (A/California/08/2009(H1N1))
       221    S  R  Y  S  K  K  F  K  P  E  I  A  I  R  P  K  V  R  D  Q 
Query  661   TCAAGATACAGCAAGAAGTTCAAGCCGGAAATAGCAATAAGACCCAAAGTGAGGGATCAA  720
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
Sbjct  681   TCAAGATACAGCAAGAAGTTCAAGCCGGAAATAGCAATAAGACCCAAAGTGAGGGAACGA  740
       221    S  R  Y  S  K  K  F  K  P  E  I  A  I  R  P  K  V  R  E  R 
(A/Novgorod/01/2009(H1N1))

[NOTE: I was focused on edit this post, and I missed the previous Recombinomics reference post, which already mentions the previous Iowa cat]

Rhiza Labs FluTracker Forum

Oregon cat dies from swine flu, officials say

Who is online